ncRNADetailInformation

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

mmu-miR-199a-5p

MI0000713	MIPF0000040	UGGAAGCUUCAGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGCCAGCA	MIMAT0000229 mmu-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000713	MIPF0000040	UGGAAGCUUCAGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGCCAGCA	MIMAT0000229 mmu-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000713	MIPF0000040	UGGAAGCUUCAGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGCCAGCA	MIMAT0000229 mmu-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.

link to database

Interacted genes from RAID,miRTarBase

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0045449	regulation of transcription	Smad4,Ikbkb,Hif1a,Sirt1,	4.39E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	Smad4,Hif1a,Sirt1,	5.97E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value