ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-32

MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0004505 hsa-miR-32-3p	CAAUUUAGUGUGUGUGAUAUUU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0004505 hsa-miR-32-3p	CAAUUUAGUGUGUGUGAUAUUU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0004505 hsa-miR-32-3p	CAAUUUAGUGUGUGUGAUAUUU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0004505 hsa-miR-32-3p	CAAUUUAGUGUGUGUGAUAUUU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000090	MIPF0000069	GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUGUGAUAUUUUC	MIMAT0000090 hsa-miR-32-5p	UAUUGCACAUUACUAAGUUGCA	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

EDEM1,ZFC3H1,PTGES2,RPE65,KLHDC5,KAT2B,ITGA6,TRIO,SIK1,GATAD2B,ARRDC4,PCTP,DOCK9,BCAT1,NUP43
more » EDEM1,ZFC3H1,PTGES2,RPE65,KLHDC5,KAT2B,ITGA6,TRIO,SIK1,GATAD2B,ARRDC4,PCTP,DOCK9,BCAT1,NUP43,VPS4B,E2F3,HBS1L,UVRAG,PRPF40A,CCDC113,ITGAV,YWHAH,TEX2,DSC3,ITM2B,USP21,USP45,FBXO28,INSIG1,UBE2Q2,ZSCAN12,APPL1,PHLPP2,SLC39A6,ZDHHC5,RHPN2,SSFA2,NHSL1,SPRYD4,FAM214A,CPEB4,STYX,PAXIP1,DNAJB9,ABCF2,MYCBP,H3F3B,SLC25A32,SLC7A11,BCL2L11,SAMD8,ZNF398,SLX4,SETD7,GRAMD4,ARGLU1,PAPD7,ZHX1,DST,CCT6A,RNF141,FAM105B,SBNO2,CCNE2,ATXN1,BICD2,BCL11A,IKZF4,HIVEP1,MFHAS1,MYO5A,MED19,FGF2,SYBU,AGTPBP1,SYNJ1,MIS12,TULP4,MRPL17,FOXN2,PRMT5,HMGCR,TMF1,ITPR1,BTBD2,MFF,RPLP1,TRIM36,TNRC6B,CREB5,NEO1,NEFL,FAM126B,GPBP1L1,NUFIP2,TXLNA,PLEKHA1,LHFPL2,NUS1,CDC27,UGP2,RBFOX2,MDM2,ANO8,DNAJB12,BTG2,TMEM188,ZNF594,SLC45A3,NR3C1,PPCS,ZXDA,MCOLN2,ASAP1,MORC3,EXOC5,CRKL,SHCBP1,GOLGA8A,PIP5K1C,RGS17,HAT1,SLC37A3,UBE2Z,BCAT2,PPP1R12C,GOLGA3,FOPNL,SPATA2,ERGIC2,BCL11B,LIN7C,TSC1,GFPT2,UBE2W,PUS7,LIN54,SUV420H1,GOLGA8B,ERBB2IP,METTL21D,MIER3,MTF1,MPP7,OSBPL8

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa00770	Pantothenate and CoA biosynthesis	PPCS,BCAT1,BCAT2,	5.37E-2
hsa05200	Pathways in cancer	ITGAV,CCNE2,CRKL,FGF2,APPL1,MDM2,ITGA6,E2F3,	9.68E-2
hsa04110	Cell cycle	CDC27,CCNE2,YWHAH,MDM2,E2F3,	1.34E-1
hsa04120	Ubiquitin mediated proteolysis	CDC27,UBE2Q2,UBE2W,UBE2Z,MDM2,	1.83E-1
hsa05222	Small cell lung cancer	ITGAV,CCNE2,ITGA6,E2F3,	2.42E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0045449	regulation of transcription	MTF1,BCL11A,GRAMD4,LIN54,NEO1,ZSCAN12,ZXDA,SBNO2,FGF2,BCL11B,IKZF4,MYCBP,GATAD2B,HAT1,PTGES2,TMF1,ZNF398,RNF141,BTG2,SUV420H1,USP21,ZHX1,KAT2B,NR3C1,HIVEP1,TULP4,RBFOX2,ATXN1,MDM2,PRMT5,FOXN2,SETD7,ZNF594,GPBP1L1,E2F3,MED19,MIER3,CREB5,SIK1,YWHAH,	1.34E-4
GO:0009791	post-embryonic development	ITPR1,BCL11B,MORC3,PLEKHA1,BCL2L11,	3.43E-2
GO:0008202	steroid metabolic process	INSIG1,PCTP,FGF2,NR3C1,HMGCR,YWHAH,OSBPL8,	7.53E-2
GO:0043434	response to peptide hormone stimulus	RPE65,TSC1,BTG2,KAT2B,APPL1,NEFL,	1.00E-1

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value