ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-31

MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0000089 hsa-miR-31-5p	AGGCAAGAUGCUGGCAUAGCU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.
MI0000089	MIPF0000064	GGAGAGGAGGCAAGAUGCUGGCAUAGCUGUUGAACUGGGAACCUGCUAUGCCAACAUAUUGCCAUCUUUCC	MIMAT0004504 hsa-miR-31-3p	UGCUAUGCCAACAUAUUGCCAU	The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies . The 5' end of the miRNA may beoffset with respect to previous annotations.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

RET,ZNF275,TXNDC5,LRRC59,SRRM2,TIAM1,MCM2,MPRIP,PDCD4,MED12,XK,RICTOR,STK40,RPS7,NFAT5
more » RET,ZNF275,TXNDC5,LRRC59,SRRM2,TIAM1,MCM2,MPRIP,PDCD4,MED12,XK,RICTOR,STK40,RPS7,NFAT5,ZC3H18,GLI2,MCM4,SELE,HIST1H2BK,FLNA,NUMB,HIST1H2BC,AKAP8L,PTPRJ,HIF1AN,FAM134C,RHOA,ITGA5,RANGAP1,DKK1,NUP188,C1orf198,GYG1,KRT16,TRRAP,ARL6IP5,PPP2R5C,DNAJC5,HEATR2,ARPC5,FOXP3,NOP56,EXOSC5,SATB2,MYO1D,FGF10,DMD,DACT3,NDFIP2,PPIA,JAZF1,DNMT3B,RPS4Y1,CREG1,EXOC6,TNKS2,NOL9,KIAA1737,CASR,STOML2,E2F2,HOXC13,LATS2,INHBA,ABCB9,ATP2A2,KRT17,MAP4K4,SLC9A6,TNRC6B,ETS1,ICAM1,DBR1,RPA1,TRIB3,RPL37A,RAN,CDK1,KIAA0528,NUS1,SMEK2,PPIL2,ILF2,NFATC2IP,CYP27B1,HOXA7,GHITM,PPP2R2A,PEX19,UBA6,FAT4,DDX19A,SFXN1,HIST1H2BJ,PRKCE,ZC3H12C,RASA1,YY1,ACADVL,PCSK1N,DLX3,WASF3,MLH1,RDX,MAP3K14,FZD3,DICER1,EDC3,MET,EIF2C1,KLF13,CXCL12

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	RET,FGF10,RHOA,MLH1,ETS1,FZD3,GLI2,MET,E2F2,	1.36E-1
hsa04360	Axon guidance	CXCL12,RHOA,NFAT5,MET,RASA1,	3.70E-1
hsa04520	Adherens junction	PTPRJ,RHOA,WASF3,MET,	3.93E-1
hsa03030	DNA replication	MCM4,RPA1,MCM2,	4.82E-1
hsa04810	Regulation of actin cytoskeleton	ARPC5,FGF10,RHOA,TIAM1,ITGA5,RDX,	5.85E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0051130	positive regulation of cellular component organization	FGF10,RHOA,TIAM1,SELE,NUMB,RICTOR,TNKS2,FOXP3,DNMT3B,	3.96E-5
GO:0033043	regulation of organelle organization	ARPC5,CXCL12,RHOA,RICTOR,TNKS2,RDX,RASA1,FOXP3,DNMT3B,	1.41E-4
GO:0010604	positive regulation of macromolecule metabolic process	MED12,HOXA7,NDFIP2,ILF2,SELE,TNKS2,GLI2,RAN,INHBA,DNMT3B,CDK1,KLF13,NFAT5,RICTOR,ETS1,SATB2,FOXP3,	2.86E-4
GO:0032956	regulation of actin cytoskeleton organization	ARPC5,CXCL12,RHOA,RICTOR,RDX,RASA1,	4.00E-4
GO:0032970	regulation of actin filament-based process	ARPC5,CXCL12,RHOA,RICTOR,RDX,RASA1,	4.66E-4

GO:0008064	regulation of actin polymerization or depolymerization	ARPC5,CXCL12,RICTOR,RDX,RASA1,	8.76E-4
GO:0030832	regulation of actin filament length	ARPC5,CXCL12,RICTOR,RDX,RASA1,	9.90E-4
GO:0045597	positive regulation of cell differentiation	CYP27B1,RHOA,TIAM1,NUMB,ETS1,GLI2,INHBA,DNMT3B,	1.13E-2
GO:0045449	regulation of transcription	MED12,ILF2,ZNF275,DLX3,FLNA,JAZF1,PDCD4,INHBA,ICAM1,DNMT3B,RHOA,HIF1AN,TRIB3,FOXP3,DMD,MCM4,YY1,HOXC13,HOXA7,EIF2C1,NFATC2IP,GLI2,RAN,MCM2,E2F2,KLF13,CREG1,FGF10,NFAT5,ETS1,TRRAP,SATB2,	1.29E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	MED12,HOXA7,ILF2,TNKS2,GLI2,RAN,ICAM1,INHBA,KLF13,NFAT5,ETS1,SATB2,FOXP3,	1.79E-2
GO:0010605	negative regulation of macromolecule metabolic process	HOXA7,NDFIP2,MLH1,EIF2C1,FLNA,JAZF1,GLI2,PDCD4,DNMT3B,INHBA,DICER1,SATB2,TNRC6B,FOXP3,	1.80E-2
GO:0045893	positive regulation of transcription, DNA-dependent	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,GLI2,SATB2,RAN,INHBA,FOXP3,	1.87E-2
GO:0051254	positive regulation of RNA metabolic process	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,GLI2,SATB2,RAN,INHBA,FOXP3,	1.98E-2
GO:0035239	tube morphogenesis	CXCL12,RET,FGF10,DICER1,FZD3,GLI2,	1.98E-2
GO:0010628	positive regulation of gene expression	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,GLI2,SATB2,RAN,INHBA,FOXP3,DNMT3B,	2.47E-2
GO:0051493	regulation of cytoskeleton organization	ARPC5,CXCL12,RHOA,RICTOR,RDX,RASA1,	2.68E-2
GO:0010638	positive regulation of organelle organization	RHOA,RICTOR,TNKS2,FOXP3,DNMT3B,	2.74E-2
GO:0010629	negative regulation of gene expression	HOXA7,NDFIP2,DICER1,EIF2C1,JAZF1,GLI2,SATB2,PDCD4,TNRC6B,FOXP3,DNMT3B,	2.79E-2
GO:0031328	positive regulation of cellular biosynthetic process	MED12,HOXA7,ILF2,TNKS2,GLI2,RAN,ICAM1,INHBA,KLF13,NFAT5,ETS1,SATB2,FOXP3,	2.98E-2
GO:0009891	positive regulation of biosynthetic process	MED12,HOXA7,ILF2,TNKS2,GLI2,RAN,ICAM1,INHBA,KLF13,NFAT5,ETS1,SATB2,FOXP3,	3.35E-2
GO:0051094	positive regulation of developmental process	CYP27B1,RHOA,TIAM1,NUMB,ETS1,GLI2,INHBA,DNMT3B,	3.40E-2
GO:0007010	cytoskeleton organization	DMD,ARPC5,RET,RHOA,MLH1,FLNA,RICTOR,WASF3,KRT16,RAN,	3.50E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,TNKS2,GLI2,SATB2,RAN,INHBA,FOXP3,	4.26E-2
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	KLF13,MED12,HOXA7,NFAT5,ETS1,GLI2,SATB2,INHBA,FOXP3,	4.53E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	YY1,MED12,HOXA7,JAZF1,GLI2,INHBA,KLF13,CREG1,RHOA,NFAT5,ETS1,SATB2,FOXP3,	4.80E-2
GO:0051674	localization of cell	CXCL12,RET,ITGA5,SELE,ETS1,MET,SATB2,ICAM1,	5.82E-2
GO:0048870	cell motility	CXCL12,RET,ITGA5,SELE,ETS1,MET,SATB2,ICAM1,	5.82E-2
GO:0048598	embryonic morphogenesis	RET,HOXA7,FGF10,DICER1,FZD3,DKK1,GLI2,SATB2,	5.82E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,TNKS2,GLI2,SATB2,RAN,INHBA,FOXP3,	6.03E-2
GO:0006928	cell motion	ARPC5,CXCL12,RET,ITGA5,SELE,ETS1,GLI2,MET,SATB2,ICAM1,	6.10E-2
GO:0045941	positive regulation of transcription	KLF13,MED12,HOXA7,ILF2,NFAT5,ETS1,GLI2,SATB2,RAN,INHBA,FOXP3,	6.14E-2
GO:0030833	regulation of actin filament polymerization	ARPC5,RICTOR,RDX,RASA1,	6.42E-2
GO:0034622	cellular macromolecular complex assembly	MLH1,DICER1,FLNA,WASF3,HIST1H2BK,HIST1H2BC,HIST1H2BJ,MCM2,	7.02E-2
GO:0016458	gene silencing	DICER1,EIF2C1,TNRC6B,DNMT3B,	7.10E-2
GO:0001568	blood vessel development	CXCL12,PTPRJ,FGF10,NUS1,DICER1,DLX3,RASA1,	7.54E-2
GO:0001944	vasculature development	CXCL12,PTPRJ,FGF10,NUS1,DICER1,DLX3,RASA1,	8.45E-2
GO:0008544	epidermis development	HOXC13,FGF10,KRT17,GLI2,KRT16,ATP2A2,	9.53E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value