ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-29b

MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000105	MIPF0000009	CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG	MIMAT0004514 hsa-miR-29b-1-5p	GCUGGUUUCAUAUGGUGGUUUAGA	Mourelatos et al. identified two copies of this sequence mapping tochromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 .Subsequent genome assemblies suggest the presence of only one miR-102locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b(MIR:MI0000143) and so has been renamed here for consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0004515 hsa-miR-29b-2-5p	CUGGUUUCACAUGGUGGCUUAG	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.
MI0000107	MIPF0000009	CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG	MIMAT0000100 hsa-miR-29b-3p	UAGCACCAUUUGAAAUCAGUGUU	This sequence was named mir-102-1 in reference . Human miR-102 is ahomologue of mouse miR-29b (MIR:MI0000143) and so has been renamed herefor consistency.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

Dusp2,FGG,SFPQ,GAPDH,Col5a3,RPS4X,HMGA2,DUSP2,BACE1,EZH2,CTNNBIP1,Fbn1,MMP24,NID1,ZC3H18
more » Dusp2,FGG,SFPQ,GAPDH,Col5a3,RPS4X,HMGA2,DUSP2,BACE1,EZH2,CTNNBIP1,Fbn1,MMP24,NID1,ZC3H18,DNAJB11,SCAF8,VEGFA,Col4a2,CDK13,MYCN,Col3a1,FGA,ESR1,Arg1,IFNG,C1orf96,Bcl2l11,SPARC,COL5A3,NKIRAS2,IMPDH1,Bmf,IGF1,Hdac4,BMP1,PRKAA1,MYC,Cav2,MMP2,TBX21,CCND2,MMP15,CECR2,IFIH1,ADAMTS7,COL4A1,COL1A1,SMARCC1,HDAC4,B4GALT5,ABL1,PDGFC,FOS,CDC42,DNMT3B,Ctnnbip1,NNT,C1QTNF6,Col1a2,LRP10,SLC16A1,Dnmt3b,Acvr2a,MRPS35,CIT,SP1,CDK6,MCL1,RSL24D1,KIAA1671,PDPN,NCOA3,CLDN1,CALU,GNB2L1,DHX40,FGB,TPT1,C5orf13,PDGFB,Tgfb3,TET1,TRPC5,NUS1,S100B,COL4A2,UROS,ADAM12,Eln,TPD52L2,Col2a1,DNMT1,MKI67,ITGB1,COL3A1,RUNDC3B,YY1,Col1a1,DNMT3A,PPP1R13B,TCL1A,PTEN,Bak1,Insig1,GRN,PIGN,Hrk,BCL2,HP1BP3,BCR,Bbc3,RAX,Dnmt3a

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa04510	Focal adhesion	PTEN,COL3A1,BCL2,COL4A1,PDGFB,COL4A2,PDGFC,IGF1,ITGB1,VEGFA,COL5A3,COL1A1,CCND2,CDC42,	2.59E-9
hsa05200	Pathways in cancer	PTEN,MMP2,BCL2,COL4A1,PDGFB,COL4A2,IGF1,ABL1,CDK6,ITGB1,VEGFA,BCR,FOS,MYC,CDC42,	1.17E-7
hsa05222	Small cell lung cancer	CDK6,ITGB1,PTEN,BCL2,COL4A1,COL4A2,MYC,	4.80E-5
hsa04512	ECM-receptor interaction	ITGB1,COL3A1,COL4A1,COL4A2,COL5A3,COL1A1,	5.12E-4
hsa05218	Melanoma	CDK6,PTEN,PDGFB,PDGFC,IGF1,	2.39E-2

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0008284	positive regulation of cell proliferation	BCL2,PDGFB,PDGFC,HDAC4,IGF1,CDK13,CDK6,IFNG,ITGB1,MYCN,VEGFA,GRN,CCND2,RPS4X,MYC,	1.42E-7
GO:0042127	regulation of cell proliferation	PTEN,BCL2,PDGFB,PDGFC,HDAC4,IGF1,SPARC,CDK13,CDK6,IFNG,ITGB1,MYCN,VEGFA,TPD52L2,GRN,CCND2,RPS4X,MYC,	3.21E-6
GO:0010604	positive regulation of macromolecule metabolic process	BCL2,SMARCC1,PDGFB,TBX21,PDGFC,HDAC4,IGF1,ESR1,DNMT1,SP1,NCOA3,DNMT3B,IFNG,VEGFA,CCND2,FOS,RPS4X,MYC,	9.99E-6
GO:0008283	cell proliferation	S100B,PTEN,BCL2,CTNNBIP1,PDPN,VEGFA,PDGFB,MKI67,NASP,IGF1,IMPDH1,MYC,	5.45E-5
GO:0001503	ossification	MMP2,BCL2,BMP1,COL1A1,IGF1,SP1,SPARC,	6.39E-5

GO:0060348	bone development	MMP2,BCL2,BMP1,COL1A1,IGF1,SP1,SPARC,	9.29E-5
GO:0001501	skeletal system development	COL3A1,MMP2,BCL2,BMP1,COL1A1,HDAC4,IGF1,SP1,SPARC,MYC,	1.18E-4
GO:0051726	regulation of cell cycle	CDK13,CDK6,ITGB1,PTEN,BCL2,CCND2,IGF1,PPP1R13B,CDC42,MYC,	1.56E-4
GO:0010810	regulation of cell-substrate adhesion	CDK6,PTEN,BCL2,NID1,COL1A1,	1.60E-4
GO:0048008	platelet-derived growth factor receptor signaling pathway	PTEN,VEGFA,PDGFB,PDGFC,	1.87E-4
GO:0010035	response to inorganic substance	PTEN,BCL2,UROS,FGB,COL1A1,FGG,FOS,FGA,	2.23E-4
GO:0051054	positive regulation of DNA metabolic process	IFNG,TBX21,PDGFB,PDGFC,IGF1,	3.45E-4
GO:0031399	regulation of protein modification process	IFNG,BCL2,PDGFB,PDGFC,HDAC4,CCND2,IGF1,DNMT1,DNMT3B,	3.76E-4
GO:0006305	DNA alkylation	FOS,DNMT1,DNMT3A,DNMT3B,	3.82E-4
GO:0006306	DNA methylation	FOS,DNMT1,DNMT3A,DNMT3B,	3.82E-4
GO:0006325	chromatin organization	CECR2,EZH2,SMARCC1,HDAC4,NASP,HMGA2,DNMT1,DNMT3A,HP1BP3,DNMT3B,	4.17E-4
GO:0032270	positive regulation of cellular protein metabolic process	IFNG,BCL2,HDAC4,CCND2,IGF1,RPS4X,DNMT1,DNMT3B,	4.84E-4
GO:0048146	positive regulation of fibroblast proliferation	CDK6,PDGFB,PDGFC,IGF1,	4.86E-4
GO:0014911	positive regulation of smooth muscle cell migration	BCL2,PDGFB,IGF1,	5.22E-4
GO:0051052	regulation of DNA metabolic process	IFNG,TBX21,PDGFB,PDGFC,IGF1,MYC,	5.98E-4
GO:0051247	positive regulation of protein metabolic process	IFNG,BCL2,HDAC4,CCND2,IGF1,RPS4X,DNMT1,DNMT3B,	6.21E-4
GO:0010628	positive regulation of gene expression	IFNG,SMARCC1,VEGFA,HDAC4,IGF1,FOS,ESR1,DNMT1,NCOA3,SP1,MYC,DNMT3B,	6.58E-4
GO:0043414	biopolymer methylation	EZH2,FOS,DNMT1,DNMT3A,DNMT3B,	7.67E-4
GO:0009891	positive regulation of biosynthetic process	PDGFB,SMARCC1,PDGFC,HDAC4,IGF1,SP1,NCOA3,IFNG,VEGFA,PRKAA1,FOS,RPS4X,MYC,	8.34E-4
GO:0006259	DNA metabolic process	CECR2,PDGFB,NASP,IGF1,ABL1,FOS,DNMT1,DNMT3A,SFPQ,MYC,DNMT3B,	8.49E-4
GO:0050678	regulation of epithelial cell proliferation	CDK6,VEGFA,GRN,CCND2,IGF1,	8.54E-4
GO:0031401	positive regulation of protein modification process	IFNG,BCL2,HDAC4,CCND2,IGF1,DNMT1,DNMT3B,	8.85E-4
GO:0030168	platelet activation	COL3A1,FGB,FGG,FGA,	9.05E-4
GO:0006304	DNA modification	FOS,DNMT1,DNMT3A,DNMT3B,	9.91E-4
GO:0048545	response to steroid hormone stimulus	PTEN,BCL2,PDGFB,COL1A1,CCND2,FOS,ESR1,	1.01E-2
GO:0032259	methylation	EZH2,FOS,DNMT1,DNMT3A,DNMT3B,	1.10E-2
GO:0010033	response to organic substance	PTEN,COL3A1,BCL2,PDGFB,HDAC4,ESR1,MCL1,IFNG,UROS,COL1A1,CCND2,FOS,MYC,	1.14E-2
GO:0048145	regulation of fibroblast proliferation	CDK6,PDGFB,PDGFC,IGF1,	1.17E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	IFNG,SMARCC1,VEGFA,TBX21,PDGFB,PDGFC,HDAC4,IGF1,FOS,NCOA3,SP1,MYC,	1.18E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	YY1,CTNNBIP1,SMARCC1,HDAC4,IGF1,ABL1,SP1,DNMT1,DNMT3A,MYCN,VEGFA,FOS,MYC,	1.23E-2
GO:0016568	chromatin modification	CECR2,EZH2,SMARCC1,HDAC4,NASP,DNMT1,DNMT3A,DNMT3B,	1.25E-2
GO:0034097	response to cytokine stimulus	COL3A1,BCL2,HDAC4,FOS,MCL1,	1.27E-2
GO:0006916	anti-apoptosis	BCL2,VEGFA,TPT1,IGF1,ESR1,MYC,MCL1,	1.45E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	IFNG,SMARCC1,VEGFA,TBX21,PDGFB,PDGFC,HDAC4,IGF1,FOS,NCOA3,SP1,MYC,	1.52E-2
GO:0070482	response to oxygen levels	MMP2,BCL2,PDPN,VEGFA,PDGFB,PRKAA1,	1.55E-2
GO:0001775	cell activation	ITGB1,COL3A1,BCL2,FGB,FGG,HDAC4,FGA,IMPDH1,	1.63E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	IFNG,SMARCC1,VEGFA,PDGFB,PDGFC,HDAC4,IGF1,RPS4X,FOS,NCOA3,SP1,MYC,	1.71E-2
GO:0042325	regulation of phosphorylation	DUSP2,IFNG,PTEN,BCL2,PDGFB,PRKAA1,PDGFC,CCND2,IGF1,CDC42,	1.82E-2
GO:0050679	positive regulation of epithelial cell proliferation	VEGFA,GRN,CCND2,IGF1,	1.87E-2
GO:0030335	positive regulation of cell migration	BCL2,PDPN,VEGFA,PDGFB,IGF1,	1.98E-2
GO:0007160	cell-matrix adhesion	ITGB1,COL3A1,BCL2,NID1,COL5A3,	1.98E-2
GO:0032268	regulation of cellular protein metabolic process	IFNG,BCL2,PDGFB,PDGFC,HDAC4,CCND2,IGF1,RPS4X,DNMT1,DNMT3B,	2.05E-2
GO:0014910	regulation of smooth muscle cell migration	BCL2,PDGFB,IGF1,	2.24E-2
GO:0051174	regulation of phosphorus metabolic process	DUSP2,IFNG,PTEN,BCL2,PDGFB,PRKAA1,PDGFC,CCND2,IGF1,CDC42,	2.39E-2
GO:0051276	chromosome organization	CECR2,EZH2,SMARCC1,HDAC4,NASP,HMGA2,DNMT1,DNMT3A,HP1BP3,DNMT3B,	2.39E-2
GO:0019220	regulation of phosphate metabolic process	DUSP2,IFNG,PTEN,BCL2,PDGFB,PRKAA1,PDGFC,CCND2,IGF1,CDC42,	2.39E-2
GO:0031328	positive regulation of cellular biosynthetic process	IFNG,SMARCC1,VEGFA,PDGFB,PDGFC,HDAC4,IGF1,RPS4X,FOS,NCOA3,SP1,MYC,	2.47E-2
GO:0044093	positive regulation of molecular function	IFNG,BCL2,PDGFB,PRKAA1,PDGFC,HDAC4,CCND2,ABL1,NCOA3,CDC42,MYC,	2.53E-2
GO:0048660	regulation of smooth muscle cell proliferation	IFNG,VEGFA,PDGFB,IGF1,	2.60E-2
GO:0051272	positive regulation of cell motion	BCL2,PDPN,VEGFA,PDGFB,IGF1,	2.81E-2
GO:0031589	cell-substrate adhesion	ITGB1,COL3A1,BCL2,NID1,COL5A3,	2.81E-2
GO:0040017	positive regulation of locomotion	BCL2,PDPN,VEGFA,PDGFB,IGF1,	2.81E-2
GO:0030097	hemopoiesis	CDK6,ITGB1,BCL2,VEGFA,HDAC4,SP1,CDC42,	2.88E-2
GO:0006355	regulation of transcription, DNA-dependent	EZH2,YY1,SMARCC1,TBX21,CTNNBIP1,HDAC4,RAX,IGF1,HMGA2,ABL1,ESR1,DNMT1,SP1,NCOA3,DNMT3A,DNMT3B,IFNG,MYCN,VEGFA,FOS,MYC,	3.34E-2
GO:0051329	interphase of mitotic cell cycle	CDK6,ITGB1,BCL2,CCND2,ABL1,	3.36E-2
GO:0030334	regulation of cell migration	PTEN,BCL2,PDPN,VEGFA,PDGFB,IGF1,	3.42E-2
GO:0030198	extracellular matrix organization	COL3A1,NID1,COL4A2,COL5A3,COL1A1,	3.48E-2
GO:0043627	response to estrogen stimulus	PTEN,BCL2,PDGFB,CCND2,ESR1,	3.60E-2
GO:0051325	interphase	CDK6,ITGB1,BCL2,CCND2,ABL1,	3.73E-2
GO:0001932	regulation of protein amino acid phosphorylation	IFNG,BCL2,PDGFB,PDGFC,CCND2,IGF1,	3.77E-2
GO:0001944	vasculature development	COL3A1,PTEN,MMP2,PDPN,VEGFA,NUS1,COL1A1,	3.90E-2
GO:0009611	response to wounding	COL3A1,BCL2,PDPN,PDGFB,FGB,FGG,HDAC4,IGF1,FOS,FGA,	4.31E-2
GO:0051252	regulation of RNA metabolic process	EZH2,YY1,SMARCC1,TBX21,CTNNBIP1,HDAC4,RAX,IGF1,HMGA2,ABL1,ESR1,DNMT1,SP1,NCOA3,DNMT3A,DNMT3B,IFNG,MYCN,VEGFA,FOS,MYC,	4.32E-2
GO:0006730	one-carbon metabolic process	EZH2,FOS,DNMT1,DNMT3A,DNMT3B,	4.54E-2
GO:0048534	hemopoietic or lymphoid organ development	CDK6,ITGB1,BCL2,VEGFA,HDAC4,SP1,CDC42,	4.63E-2
GO:0032844	regulation of homeostatic process	CDK6,IFNG,BCL2,VEGFA,MYC,	4.83E-2
GO:0043066	negative regulation of apoptosis	PTEN,BCL2,VEGFA,TPT1,IGF1,ESR1,MYC,MCL1,	5.24E-2
GO:0043069	negative regulation of programmed cell death	PTEN,BCL2,VEGFA,TPT1,IGF1,ESR1,MYC,MCL1,	5.65E-2
GO:0042060	wound healing	COL3A1,PDGFB,FGB,FGG,IGF1,FGA,	5.73E-2
GO:0060548	negative regulation of cell death	PTEN,BCL2,VEGFA,TPT1,IGF1,ESR1,MYC,MCL1,	5.73E-2
GO:0040012	regulation of locomotion	PTEN,BCL2,PDPN,VEGFA,PDGFB,IGF1,	5.86E-2
GO:0051270	regulation of cell motion	PTEN,BCL2,PDPN,VEGFA,PDGFB,IGF1,	5.99E-2
GO:0002520	immune system development	CDK6,ITGB1,BCL2,VEGFA,HDAC4,SP1,CDC42,	6.17E-2
GO:0007049	cell cycle	CDK6,IFNG,ITGB1,BCL2,PDPN,MKI67,CCND2,NASP,HMGA2,ABL1,CIT,MYC,	6.34E-2
GO:0022402	cell cycle process	CDK6,IFNG,ITGB1,BCL2,MKI67,CCND2,HMGA2,ABL1,CIT,MYC,	6.51E-2
GO:0048754	branching morphogenesis of a tube	BCL2,MYCN,VEGFA,IGF1,	6.91E-2
GO:0035239	tube morphogenesis	BCL2,MYCN,PDPN,VEGFA,IGF1,	7.06E-2
GO:0010038	response to metal ion	PTEN,BCL2,FGB,FGG,FGA,	7.45E-2
GO:0045893	positive regulation of transcription, DNA-dependent	IFNG,SMARCC1,VEGFA,HDAC4,IGF1,FOS,NCOA3,SP1,MYC,	7.62E-2
GO:0050730	regulation of peptidyl-tyrosine phosphorylation	IFNG,PDGFB,PDGFC,IGF1,	7.83E-2
GO:0051254	positive regulation of RNA metabolic process	IFNG,SMARCC1,VEGFA,HDAC4,IGF1,FOS,NCOA3,SP1,MYC,	7.99E-2
GO:0042981	regulation of apoptosis	IFIH1,IFNG,PTEN,BCL2,VEGFA,TPT1,IGF1,ABL1,ESR1,PPP1R13B,MYC,MCL1,	8.20E-2
GO:0051301	cell division	CECR2,CDK13,CDK6,CCND2,HMGA2,CIT,CDC42,	8.45E-2
GO:0001666	response to hypoxia	MMP2,BCL2,VEGFA,PDGFB,PRKAA1,	8.50E-2
GO:0043067	regulation of programmed cell death	IFIH1,IFNG,PTEN,BCL2,VEGFA,TPT1,IGF1,ABL1,ESR1,PPP1R13B,MYC,MCL1,	8.80E-2
GO:0010941	regulation of cell death	IFIH1,IFNG,PTEN,BCL2,VEGFA,TPT1,IGF1,ABL1,ESR1,PPP1R13B,MYC,MCL1,	9.03E-2
GO:0030155	regulation of cell adhesion	CDK6,PTEN,BCL2,NID1,COL1A1,	9.17E-2
GO:0045596	negative regulation of cell differentiation	EZH2,CDK6,ITGB1,HDAC4,IGF1,TCL1A,	9.51E-2
GO:0033043	regulation of organelle organization	CDK13,IGF1,DNMT1,CDC42,MYC,DNMT3B,	9.69E-2
GO:0001763	morphogenesis of a branching structure	BCL2,MYCN,VEGFA,IGF1,	9.88E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value