ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-214

MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0000265 hsa-miR-204-5p	UUCCCUUUGUCAUCCUAUGCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0022693 hsa-miR-204-3p	GCUGGGAAGGCAAAGGGACGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0000265 hsa-miR-204-5p	UUCCCUUUGUCAUCCUAUGCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0022693 hsa-miR-204-3p	GCUGGGAAGGCAAAGGGACGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0000265 hsa-miR-204-5p	UUCCCUUUGUCAUCCUAUGCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000284	MIPF0000042	GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC	MIMAT0022693 hsa-miR-204-3p	GCUGGGAAGGCAAAGGGACGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0000271 hsa-miR-214-3p	ACAGCAGGCACAGACAGGCAGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.
MI0000290	MIPF0000062	GGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCU	MIMAT0004564 hsa-miR-214-5p	UGCCUGUCUACACUUGCUGUGC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human . The mature sequence shown hererepresents the most commonly cloned form from large-scale cloning studies.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

FLOT1,ADORA2B,EZH2,ATF4,PTENP1,ASF1B,AP3B1,HTT,MAPK8,MAP2K5,XBP1,POU4F2,YWHAQ,PSMD10,QKI
more » FLOT1,ADORA2B,EZH2,ATF4,PTENP1,ASF1B,AP3B1,HTT,MAPK8,MAP2K5,XBP1,POU4F2,YWHAQ,PSMD10,QKI,LTF,GALNT7,RASA1,ARL2,AHSA1,MAPK14,BCL2L2,SRGAP1,MAP2K3,CTNNB1,TP53,PLXNB1,CPNE7,DAPK1,HSPD1,PTEN,SRGAP2,TWIST1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa04722	Neurotrophin signaling pathway	YWHAQ,MAPK8,MAPK14,ATF4,MAP2K5,TP53,	7.03E-5
hsa04010	MAPK signaling pathway	MAPK8,MAPK14,MAP2K3,ATF4,MAP2K5,TP53,RASA1,	3.00E-4
hsa05215	Prostate cancer	PTEN,ATF4,PTENP1,TP53,CTNNB1,	4.10E-2
hsa04912	GnRH signaling pathway	MAPK8,MAPK14,MAP2K3,ATF4,	5.37E-2
hsa04360	Axon guidance	PLXNB1,SRGAP1,RASA1,SRGAP2,	1.14E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0043066	negative regulation of apoptosis	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	4.47E-6
GO:0043069	negative regulation of programmed cell death	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	4.90E-6
GO:0060548	negative regulation of cell death	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	5.00E-6
GO:0007242	intracellular signaling cascade	YWHAQ,MAPK8,MAPK14,MAP2K3,ADORA2B,MAP2K5,ARL2,PLXNB1,DAPK1,TP53,CTNNB1,RASA1,	1.35E-5
GO:0006915	apoptosis	TWIST1,PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,CTNNB1,HTT,HSPD1,	1.53E-5

GO:0012501	programmed cell death	TWIST1,PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,CTNNB1,HTT,HSPD1,	1.71E-5
GO:0008219	cell death	TWIST1,PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,CTNNB1,HTT,HSPD1,	5.51E-5
GO:0016265	death	TWIST1,PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,CTNNB1,HTT,HSPD1,	5.79E-5
GO:0007243	protein kinase cascade	MAPK8,MAPK14,MAP2K3,ADORA2B,MAP2K5,DAPK1,	7.31E-4
GO:0048514	blood vessel morphogenesis	QKI,PTEN,MAPK14,PTENP1,CTNNB1,RASA1,	7.61E-4
GO:0042981	regulation of apoptosis	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	7.93E-4
GO:0043067	regulation of programmed cell death	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	8.41E-4
GO:0010941	regulation of cell death	PTEN,MAPK8,BCL2L2,PTENP1,DAPK1,TP53,RASA1,HTT,HSPD1,	8.60E-4
GO:0045597	positive regulation of cell differentiation	AP3B1,MAPK14,PLXNB1,POU4F2,CTNNB1,	1.03E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	MAPK14,MAP2K3,ADORA2B,ATF4,POU4F2,TP53,CTNNB1,	1.21E-2
GO:0001568	blood vessel development	QKI,PTEN,MAPK14,PTENP1,CTNNB1,RASA1,	1.32E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	MAPK14,MAP2K3,ADORA2B,ATF4,POU4F2,TP53,CTNNB1,	1.42E-2
GO:0043065	positive regulation of apoptosis	PTEN,MAPK8,PTENP1,DAPK1,TP53,HTT,HSPD1,	1.43E-2
GO:0001944	vasculature development	QKI,PTEN,MAPK14,PTENP1,CTNNB1,RASA1,	1.45E-2
GO:0043068	positive regulation of programmed cell death	PTEN,MAPK8,PTENP1,DAPK1,TP53,HTT,HSPD1,	1.47E-2
GO:0010942	positive regulation of cell death	PTEN,MAPK8,PTENP1,DAPK1,TP53,HTT,HSPD1,	1.51E-2
GO:0051252	regulation of RNA metabolic process	EZH2,YWHAQ,XBP1,TWIST1,MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,RASA1,	1.75E-2
GO:0031328	positive regulation of cellular biosynthetic process	MAPK14,MAP2K3,ADORA2B,ATF4,POU4F2,TP53,CTNNB1,	1.95E-2
GO:0010038	response to metal ion	PTEN,MAPK8,PTENP1,CTNNB1,HTT,	2.09E-2
GO:0009891	positive regulation of biosynthetic process	MAPK14,MAP2K3,ADORA2B,ATF4,POU4F2,TP53,CTNNB1,	2.10E-2
GO:0051094	positive regulation of developmental process	AP3B1,MAPK14,PLXNB1,POU4F2,CTNNB1,	2.10E-2
GO:0006928	cell motion	TWIST1,PTEN,MAPK8,MAPK14,PTENP1,PLXNB1,POU4F2,	2.22E-2
GO:0045893	positive regulation of transcription, DNA-dependent	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	2.26E-2
GO:0051254	positive regulation of RNA metabolic process	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	2.34E-2
GO:0006917	induction of apoptosis	PTEN,MAPK8,PTENP1,DAPK1,TP53,HTT,	3.50E-2
GO:0012502	induction of programmed cell death	PTEN,MAPK8,PTENP1,DAPK1,TP53,HTT,	3.54E-2
GO:0045941	positive regulation of transcription	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	4.66E-2
GO:0045892	negative regulation of transcription, DNA-dependent	YWHAQ,TWIST1,POU4F2,TP53,CTNNB1,	5.12E-2
GO:0010628	positive regulation of gene expression	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	5.28E-2
GO:0051253	negative regulation of RNA metabolic process	YWHAQ,TWIST1,POU4F2,TP53,CTNNB1,	5.43E-2
GO:0000165	MAPKKK cascade	MAPK8,MAP2K3,ADORA2B,MAP2K5,	5.69E-2
GO:0006355	regulation of transcription, DNA-dependent	EZH2,YWHAQ,XBP1,TWIST1,MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	5.70E-2
GO:0016331	morphogenesis of embryonic epithelium	TWIST1,CTNNB1,HTT,	5.91E-2
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	MAPK14,ATF4,POU4F2,TP53,CTNNB1,	5.92E-2
GO:0010604	positive regulation of macromolecule metabolic process	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,PSMD10,	5.95E-2
GO:0010035	response to inorganic substance	PTEN,MAPK8,PTENP1,CTNNB1,HTT,	7.67E-2
GO:0034613	cellular protein localization	YWHAQ,AP3B1,TP53,CTNNB1,HTT,	8.46E-2
GO:0007369	gastrulation	TP53,CTNNB1,HTT,	8.52E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	MAPK14,MAP2K3,ATF4,POU4F2,TP53,CTNNB1,	8.65E-2
GO:0070727	cellular macromolecule localization	YWHAQ,AP3B1,TP53,CTNNB1,HTT,	8.68E-2
GO:0006605	protein targeting	YWHAQ,AP3B1,TP53,HTT,	8.74E-2
GO:0045596	negative regulation of cell differentiation	EZH2,TWIST1,TP53,CTNNB1,	8.85E-2
GO:0006468	protein amino acid phosphorylation	MAPK8,MAPK14,MAP2K3,ADORA2B,MAP2K5,DAPK1,	9.38E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value