ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-210

MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0000267 hsa-miR-210-3p	CUGUGCGUGUGACAGCGGCUGA	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .
MI0000286	MIPF0000086	ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC	MIMAT0026475 hsa-miR-210-5p	AGCCCCUGCCCACCGCACACUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Itsexpression was later verified in human BC-1 cells .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

MRE11A,MID1IP1,MNT,GPD1L,CDK10,HOXA3,BAX,P4HB,ISCU,HOXA9,XPA,PIM1,EFNA3,HECTD1,PTPN1
more » MRE11A,MID1IP1,MNT,GPD1L,CDK10,HOXA3,BAX,P4HB,ISCU,HOXA9,XPA,PIM1,EFNA3,HECTD1,PTPN1,FGFRL1,FAM116A,ACVR1B,ESPL1,PTAR1,ABCB9,TP53I11,XIST,CHD9,MIB1,CBX1,AIFM3,SEH1L,U2AF2,KIAA1161,TNPO1,CPEB2,BCL2,CLASP2,MDGA1,E2F3,DDAH1,HIF1A,CASP8AP2,UBQLN1,SMCHD1,HOXA1,ELK3,PFDN2,SCN1B,ATP11C,NCAM1,BDNF,APC,RCC2,VMP1,BNIP3,ACTR1A,SERTAD2,NIPBL,NPTX1,RAD52

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05210	Colorectal cancer	BCL2,BAX,ACVR1B,APC,	2.96E-2
hsa05200	Pathways in cancer	BCL2,BAX,ACVR1B,HIF1A,APC,E2F3,	4.61E-2
hsa04722	Neurotrophin signaling pathway	BCL2,BAX,BDNF,	6.99E-1
hsa03440	Homologous recombination	MRE11A,RAD52,	9.47E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0022403	cell cycle phase	RCC2,PIM1,BCL2,MRE11A,NIPBL,RAD52,ACVR1B,CLASP2,APC,SEH1L,CDK10,ESPL1,	3.76E-7
GO:0007049	cell cycle	RCC2,CASP8AP2,BCL2,MRE11A,RAD52,ACVR1B,APC,E2F3,ESPL1,PIM1,NIPBL,CLASP2,SEH1L,CDK10,	5.19E-6
GO:0022402	cell cycle process	RCC2,PIM1,BCL2,MRE11A,NIPBL,RAD52,ACVR1B,CLASP2,APC,SEH1L,CDK10,ESPL1,	7.77E-6
GO:0000278	mitotic cell cycle	RCC2,PIM1,BCL2,NIPBL,ACVR1B,CLASP2,APC,SEH1L,CDK10,ESPL1,	1.01E-5
GO:0048285	organelle fission	RCC2,NIPBL,BAX,CLASP2,APC,SEH1L,ESPL1,	2.34E-4

GO:0000279	M phase	RCC2,MRE11A,NIPBL,RAD52,CLASP2,APC,SEH1L,ESPL1,	2.46E-4
GO:0046668	regulation of retinal cell programmed cell death	BCL2,BAX,BDNF,	3.00E-4
GO:0008285	negative regulation of cell proliferation	BCL2,TP53I11,BAX,BDNF,APC,FGFRL1,MNT,CDK10,	4.32E-4
GO:0051276	chromosome organization	MRE11A,NIPBL,CBX1,SMCHD1,APC,SEH1L,BNIP3,CHD9,ESPL1,	4.83E-4
GO:0051094	positive regulation of developmental process	BCL2,BAX,ACVR1B,HIF1A,BDNF,APC,DDAH1,	6.57E-4
GO:0042127	regulation of cell proliferation	BCL2,TP53I11,BAX,HIF1A,BDNF,APC,HOXA3,FGFRL1,MNT,CDK10,E2F3,	7.13E-4
GO:0060249	anatomical structure homeostasis	BCL2,MRE11A,BAX,HIF1A,APC,	7.22E-4
GO:0051881	regulation of mitochondrial membrane potential	BCL2,BAX,AIFM3,	7.79E-4
GO:0046902	regulation of mitochondrial membrane permeability	BCL2,BAX,BNIP3,	7.79E-4
GO:0042981	regulation of apoptosis	CASP8AP2,PIM1,BCL2,BAX,ACVR1B,BDNF,APC,BNIP3,AIFM3,MNT,XPA,	8.41E-4
GO:0043067	regulation of programmed cell death	CASP8AP2,PIM1,BCL2,BAX,ACVR1B,BDNF,APC,BNIP3,AIFM3,MNT,XPA,	9.08E-4
GO:0010941	regulation of cell death	CASP8AP2,PIM1,BCL2,BAX,ACVR1B,BDNF,APC,BNIP3,AIFM3,MNT,XPA,	9.34E-4
GO:0043065	positive regulation of apoptosis	CASP8AP2,BCL2,BAX,ACVR1B,APC,BNIP3,AIFM3,XPA,	1.21E-2
GO:0043068	positive regulation of programmed cell death	CASP8AP2,BCL2,BAX,ACVR1B,APC,BNIP3,AIFM3,XPA,	1.26E-2
GO:0010942	positive regulation of cell death	CASP8AP2,BCL2,BAX,ACVR1B,APC,BNIP3,AIFM3,XPA,	1.29E-2
GO:0007067	mitosis	RCC2,NIPBL,CLASP2,APC,SEH1L,ESPL1,	1.51E-2
GO:0000280	nuclear division	RCC2,NIPBL,CLASP2,APC,SEH1L,ESPL1,	1.51E-2
GO:0051726	regulation of cell cycle	PIM1,BCL2,BAX,APC,MNT,CDK10,ESPL1,	1.61E-2
GO:0000087	M phase of mitotic cell cycle	RCC2,NIPBL,CLASP2,APC,SEH1L,ESPL1,	1.64E-2
GO:0031114	regulation of microtubule depolymerization	MID1IP1,CLASP2,APC,	1.68E-2
GO:0007026	negative regulation of microtubule depolymerization	MID1IP1,CLASP2,APC,	1.68E-2
GO:0031111	negative regulation of microtubule polymerization or depolymerization	MID1IP1,CLASP2,APC,	1.89E-2
GO:0009952	anterior/posterior pattern formation	HOXA1,HOXA9,MIB1,APC,HOXA3,	2.02E-2
GO:0051402	neuron apoptosis	BCL2,BAX,BNIP3,	2.37E-2
GO:0048538	thymus development	BCL2,APC,HOXA3,	3.18E-2
GO:0010639	negative regulation of organelle organization	MID1IP1,CLASP2,APC,ESPL1,	3.83E-2
GO:0032989	cellular component morphogenesis	BCL2,HOXA1,BAX,HIF1A,BDNF,CLASP2,APC,	4.00E-2
GO:0021675	nerve development	HOXA1,BDNF,HOXA3,	4.10E-2
GO:0051301	cell division	RCC2,CLASP2,APC,SEH1L,CDK10,ESPL1,	5.36E-2
GO:0001822	kidney development	BCL2,BAX,BDNF,APC,	5.95E-2
GO:0031110	regulation of microtubule polymerization or depolymerization	MID1IP1,CLASP2,APC,	6.27E-2
GO:0007006	mitochondrial membrane organization	BCL2,BAX,BNIP3,	6.67E-2
GO:0003002	regionalization	HOXA1,HOXA9,MIB1,APC,HOXA3,	6.84E-2
GO:0051329	interphase of mitotic cell cycle	PIM1,BCL2,ACVR1B,CDK10,	7.22E-2
GO:0006917	induction of apoptosis	CASP8AP2,BAX,ACVR1B,BNIP3,AIFM3,XPA,	7.51E-2
GO:0012502	induction of programmed cell death	CASP8AP2,BAX,ACVR1B,BNIP3,AIFM3,XPA,	7.61E-2
GO:0051325	interphase	PIM1,BCL2,ACVR1B,CDK10,	7.82E-2
GO:0000070	mitotic sister chromatid segregation	NIPBL,SEH1L,ESPL1,	8.39E-2
GO:0019725	cellular homeostasis	BCL2,BAX,HIF1A,APC,P4HB,BNIP3,AIFM3,	8.61E-2
GO:0043009	chordate embryonic development	HOXA9,ACVR1B,MIB1,HIF1A,HOXA3,HECTD1,	8.63E-2
GO:0001655	urogenital system development	BCL2,BAX,BDNF,APC,	8.65E-2
GO:0000819	sister chromatid segregation	NIPBL,SEH1L,ESPL1,	8.85E-2
GO:0009792	embryonic development ending in birth or egg hatching	HOXA9,ACVR1B,MIB1,HIF1A,HOXA3,HECTD1,	8.95E-2
GO:0006928	cell motion	HOXA1,MDGA1,BAX,HIF1A,BDNF,CLASP2,APC,	9.41E-2
GO:0032844	regulation of homeostatic process	BCL2,BAX,ACVR1B,HIF1A,	9.54E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value