ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-205

MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0009197 hsa-miR-205-3p	GAUUUCAGUGGAGUGAAGUUC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .
MI0000285	MIPF0000058	AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA	MIMAT0000266 hsa-miR-205-5p	UCCUUCAUUCCACCGGAGUCUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Landgrafet al. confirm expression in human .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

VEGFA,PHLPP2,LYN,MED1,DDX5,YWHAZ,STAT3,CASP7,ERBB2,CTGF,PRKCE,SIGMAR1,IL24,ZEB2,BCL2
more » VEGFA,PHLPP2,LYN,MED1,DDX5,YWHAZ,STAT3,CASP7,ERBB2,CTGF,PRKCE,SIGMAR1,IL24,ZEB2,BCL2,LRRK2,E2F1,ERBB3,PTPN13,YES1,ZEB1,KRT14,E2F5,TP73,LRP1,LAMC1,IL32,INPPL1,CYR61,SRC,PTEN

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	ERBB2,PTEN,E2F1,BCL2,VEGFA,STAT3,LAMC1,CASP3,	2.30E-4
hsa04510	Focal adhesion	ERBB2,SRC,PTEN,BCL2,VEGFA,LAMC1,	1.11E-2
hsa05212	Pancreatic cancer	ERBB2,E2F1,VEGFA,STAT3,	3.01E-2
hsa05222	Small cell lung cancer	PTEN,E2F1,BCL2,LAMC1,	4.66E-2
hsa05215	Prostate cancer	ERBB2,PTEN,E2F1,BCL2,	5.48E-2

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0008283	cell proliferation	ERBB2,SRC,PTEN,E2F1,CYR61,BCL2,VEGFA,LRP1,ZEB2,ZEB1,	2.70E-7
GO:0042325	regulation of phosphorylation	ERBB2,PTEN,BCL2,LRP1,TP73,LYN,ZEB2,CASP3,PRKCE,	5.59E-6
GO:0043067	regulation of programmed cell death	ERBB2,SRC,PTEN,BCL2,ERBB3,VEGFA,LRRK2,YWHAZ,TP73,CASP3,PRKCE,	5.73E-6
GO:0010941	regulation of cell death	ERBB2,SRC,PTEN,BCL2,ERBB3,VEGFA,LRRK2,YWHAZ,TP73,CASP3,PRKCE,	5.92E-6
GO:0042493	response to drug	ERBB2,PTEN,BCL2,ERBB3,STAT3,YWHAZ,LYN,	6.66E-6

GO:0019220	regulation of phosphate metabolic process	ERBB2,PTEN,BCL2,LRP1,TP73,LYN,ZEB2,CASP3,PRKCE,	7.51E-6
GO:0051174	regulation of phosphorus metabolic process	ERBB2,PTEN,BCL2,LRP1,TP73,LYN,ZEB2,CASP3,PRKCE,	7.51E-6
GO:0007169	transmembrane receptor protein tyrosine kinase signaling pathway	ERBB2,SRC,PTEN,ERBB3,VEGFA,STAT3,CTGF,	8.20E-6
GO:0007423	sensory organ development	ERBB2,BCL2,ERBB3,VEGFA,STAT3,ZEB1,MED1,	9.31E-6
GO:0043066	negative regulation of apoptosis	ERBB2,PTEN,BCL2,ERBB3,VEGFA,YWHAZ,TP73,CASP3,	9.58E-6
GO:0043069	negative regulation of programmed cell death	ERBB2,PTEN,BCL2,ERBB3,VEGFA,YWHAZ,TP73,CASP3,	1.05E-5
GO:0060548	negative regulation of cell death	ERBB2,PTEN,BCL2,ERBB3,VEGFA,YWHAZ,TP73,CASP3,	1.07E-5
GO:0030155	regulation of cell adhesion	ERBB2,SRC,PTEN,CYR61,BCL2,ERBB3,	1.15E-5
GO:0001836	release of cytochrome c from mitochondria	BCL2,CASP7,TP73,CASP3,	1.27E-5
GO:0009611	response to wounding	ERBB2,BCL2,ERBB3,STAT3,CTGF,YWHAZ,TP73,LYN,CASP3,	1.43E-5
GO:0006796	phosphate metabolic process	PTPN13,ERBB2,SRC,PTEN,BCL2,ERBB3,LRRK2,YES1,INPPL1,LYN,PRKCE,	2.81E-5
GO:0006793	phosphorus metabolic process	PTPN13,ERBB2,SRC,PTEN,BCL2,ERBB3,LRRK2,YES1,INPPL1,LYN,PRKCE,	2.81E-5
GO:0042981	regulation of apoptosis	ERBB2,SRC,PTEN,BCL2,ERBB3,VEGFA,YWHAZ,TP73,CASP3,PRKCE,	4.07E-5
GO:0008637	apoptotic mitochondrial changes	BCL2,CASP7,TP73,CASP3,	4.24E-5
GO:0010604	positive regulation of macromolecule metabolic process	E2F1,BCL2,VEGFA,STAT3,LRRK2,DDX5,TP73,LYN,ZEB1,MED1,	6.71E-5
GO:0007167	enzyme linked receptor protein signaling pathway	ERBB2,SRC,PTEN,ERBB3,VEGFA,STAT3,CTGF,	8.87E-5
GO:0007507	heart development	ERBB2,PTEN,ERBB3,CASP7,CASP3,MED1,	9.97E-5
GO:0035295	tube development	CYR61,BCL2,VEGFA,CTGF,ZEB2,MED1,	1.11E-4
GO:0010033	response to organic substance	ERBB2,SRC,PTEN,CYR61,BCL2,ERBB3,STAT3,LYN,CASP3,	1.28E-4
GO:0009725	response to hormone stimulus	ERBB2,SRC,PTEN,BCL2,ERBB3,STAT3,LYN,	1.30E-4
GO:0018108	peptidyl-tyrosine phosphorylation	ERBB2,SRC,ERBB3,LYN,	1.40E-4
GO:0018212	peptidyl-tyrosine modification	ERBB2,SRC,ERBB3,LYN,	1.59E-4
GO:0010627	regulation of protein kinase cascade	ERBB2,PTEN,ERBB3,TP73,LYN,ZEB2,	1.98E-4
GO:0009719	response to endogenous stimulus	ERBB2,SRC,PTEN,BCL2,ERBB3,STAT3,LYN,	2.23E-4
GO:0007005	mitochondrion organization	BCL2,CASP7,YWHAZ,TP73,CASP3,	2.31E-4
GO:0042127	regulation of cell proliferation	ERBB2,PTEN,BCL2,ERBB3,VEGFA,LAMC1,LYN,ZEB1,CASP3,	2.35E-4
GO:0006915	apoptosis	PTEN,E2F1,BCL2,ERBB3,CASP7,TP73,CASP3,IL24,	2.77E-4
GO:0012501	programmed cell death	PTEN,E2F1,BCL2,ERBB3,CASP7,TP73,CASP3,IL24,	3.03E-4
GO:0043068	positive regulation of programmed cell death	SRC,PTEN,BCL2,LRRK2,TP73,CASP3,PRKCE,	3.20E-4
GO:0010942	positive regulation of cell death	SRC,PTEN,BCL2,LRRK2,TP73,CASP3,PRKCE,	3.28E-4
GO:0030182	neuron differentiation	ERBB2,PTEN,BCL2,ERBB3,VEGFA,STAT3,TP73,	3.41E-4
GO:0031399	regulation of protein modification process	BCL2,LRRK2,TP73,LYN,ZEB2,PRKCE,	4.34E-4
GO:0009967	positive regulation of signal transduction	ERBB2,SRC,ERBB3,VEGFA,LYN,ZEB2,	4.34E-4
GO:0006468	protein amino acid phosphorylation	ERBB2,SRC,BCL2,ERBB3,LRRK2,YES1,LYN,PRKCE,	5.16E-4
GO:0006928	cell motion	ERBB2,SRC,PTEN,STAT3,LAMC1,CTGF,ZEB2,	5.25E-4
GO:0001932	regulation of protein amino acid phosphorylation	BCL2,TP73,LYN,ZEB2,PRKCE,	5.45E-4
GO:0022612	gland morphogenesis	ERBB2,BCL2,ERBB3,	5.59E-4
GO:0034097	response to cytokine stimulus	SRC,BCL2,STAT3,CASP3,	6.94E-4
GO:0010647	positive regulation of cell communication	ERBB2,SRC,ERBB3,VEGFA,LYN,ZEB2,	7.13E-4
GO:0051402	neuron apoptosis	BCL2,ERBB3,CASP3,	7.94E-4
GO:0048008	platelet-derived growth factor receptor signaling pathway	SRC,PTEN,VEGFA,	7.94E-4
GO:0048545	response to steroid hormone stimulus	ERBB2,SRC,PTEN,BCL2,STAT3,	8.07E-4
GO:0008219	cell death	PTEN,E2F1,BCL2,ERBB3,CASP7,TP73,CASP3,IL24,	8.08E-4
GO:0048666	neuron development	ERBB2,PTEN,BCL2,ERBB3,VEGFA,TP73,	8.16E-4
GO:0016265	death	PTEN,E2F1,BCL2,ERBB3,CASP7,TP73,CASP3,IL24,	8.42E-4
GO:0048678	response to axon injury	ERBB2,BCL2,LYN,	8.81E-4
GO:0045859	regulation of protein kinase activity	ERBB2,PTEN,LRP1,TP73,ZEB2,CASP3,	8.83E-4
GO:0043549	regulation of kinase activity	ERBB2,PTEN,LRP1,TP73,ZEB2,CASP3,	1.02E-2
GO:0007242	intracellular signaling cascade	ERBB2,SRC,ERBB3,STAT3,LRRK2,CTGF,TP73,LYN,MED1,PRKCE,	1.17E-2
GO:0051338	regulation of transferase activity	ERBB2,PTEN,LRP1,TP73,ZEB2,CASP3,	1.23E-2
GO:0001101	response to acid	SRC,BCL2,LYN,	1.27E-2
GO:0045941	positive regulation of transcription	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	1.29E-2
GO:0048872	homeostasis of number of cells	BCL2,VEGFA,LYN,CASP3,	1.37E-2
GO:0060429	epithelium development	BCL2,VEGFA,KRT14,ZEB2,CASP3,	1.50E-2
GO:0010628	positive regulation of gene expression	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	1.50E-2
GO:0016310	phosphorylation	ERBB2,SRC,BCL2,ERBB3,LRRK2,YES1,LYN,PRKCE,	1.51E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	2.16E-2
GO:0043065	positive regulation of apoptosis	SRC,PTEN,BCL2,TP73,CASP3,PRKCE,	2.34E-2
GO:0014070	response to organic cyclic substance	PTEN,BCL2,STAT3,LYN,	2.37E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	2.53E-2
GO:0035239	tube morphogenesis	CYR61,BCL2,VEGFA,ZEB2,	2.72E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	2.73E-2
GO:0048511	rhythmic process	ERBB2,BCL2,ERBB3,VEGFA,	2.78E-2
GO:0001654	eye development	VEGFA,STAT3,ZEB1,MED1,	3.04E-2
GO:0016477	cell migration	SRC,PTEN,LAMC1,CTGF,ZEB2,	3.05E-2
GO:0031328	positive regulation of cellular biosynthetic process	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	3.44E-2
GO:0032268	regulation of cellular protein metabolic process	BCL2,LRRK2,TP73,LYN,ZEB2,PRKCE,	3.56E-2
GO:0006955	immune response	BCL2,VEGFA,YWHAZ,IL32,INPPL1,LYN,ZEB1,	3.57E-2
GO:0045893	positive regulation of transcription, DNA-dependent	E2F1,VEGFA,STAT3,TP73,ZEB1,MED1,	3.66E-2
GO:0050679	positive regulation of epithelial cell proliferation	ERBB2,VEGFA,LAMC1,	3.69E-2
GO:0009891	positive regulation of biosynthetic process	E2F1,VEGFA,STAT3,DDX5,TP73,ZEB1,MED1,	3.70E-2
GO:0051254	positive regulation of RNA metabolic process	E2F1,VEGFA,STAT3,TP73,ZEB1,MED1,	3.79E-2
GO:0007155	cell adhesion	SRC,CYR61,BCL2,LAMC1,CTGF,IL32,INPPL1,	3.83E-2
GO:0022610	biological adhesion	SRC,CYR61,BCL2,LAMC1,CTGF,IL32,INPPL1,	3.86E-2
GO:0001525	angiogenesis	PTEN,CYR61,VEGFA,CTGF,	4.19E-2
GO:0002553	histamine secretion by mast cell	YWHAZ,LYN,	4.43E-2
GO:0002441	histamine secretion during acute inflammatory response	YWHAZ,LYN,	4.43E-2
GO:0001821	histamine secretion	YWHAZ,LYN,	4.43E-2
GO:0002349	histamine production during acute inflammatory response	YWHAZ,LYN,	4.43E-2
GO:0051674	localization of cell	SRC,PTEN,LAMC1,CTGF,ZEB2,	4.47E-2
GO:0048870	cell motility	SRC,PTEN,LAMC1,CTGF,ZEB2,	4.47E-2
GO:0030900	forebrain development	SRC,E2F1,TP73,ZEB2,	4.52E-2
GO:0010810	regulation of cell-substrate adhesion	PTEN,CYR61,BCL2,	4.63E-2
GO:0043434	response to peptide hormone stimulus	BCL2,ERBB3,STAT3,LYN,	4.68E-2
GO:0043524	negative regulation of neuron apoptosis	BCL2,ERBB3,TP73,	5.66E-2
GO:0010001	glial cell differentiation	ERBB2,ERBB3,LYN,	6.10E-2
GO:0040008	regulation of growth	CYR61,BCL2,STAT3,CTGF,TP73,	6.47E-2
GO:0051608	histamine transport	YWHAZ,LYN,	6.63E-2
GO:0048771	tissue remodeling	ERBB2,ERBB3,VEGFA,	6.79E-2
GO:0009411	response to UV	BCL2,CASP7,CASP3,	7.52E-2
GO:0008544	epidermis development	BCL2,CTGF,KRT14,CASP3,	7.67E-2
GO:0045785	positive regulation of cell adhesion	ERBB2,SRC,CYR61,	7.76E-2
GO:0008285	negative regulation of cell proliferation	ERBB2,PTEN,BCL2,ZEB1,CASP3,	7.89E-2
GO:0022602	ovulation cycle process	ERBB2,BCL2,VEGFA,	8.27E-2
GO:0009628	response to abiotic stimulus	BCL2,CASP7,KRT14,LYN,CASP3,	8.44E-2
GO:0007243	protein kinase cascade	ERBB2,SRC,ERBB3,STAT3,LRRK2,	8.59E-2
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	E2F1,VEGFA,STAT3,ZEB1,MED1,	8.68E-2
GO:0051270	regulation of cell motion	PTEN,BCL2,VEGFA,LYN,	8.74E-2
GO:0045471	response to ethanol	PTEN,BCL2,STAT3,	8.80E-2
GO:0001558	regulation of cell growth	CYR61,BCL2,CTGF,TP73,	8.86E-2
GO:0048754	branching morphogenesis of a tube	CYR61,BCL2,VEGFA,	9.06E-2
GO:0042063	gliogenesis	ERBB2,ERBB3,LYN,	9.06E-2
GO:0007398	ectoderm development	BCL2,CTGF,KRT14,CASP3,	9.50E-2
GO:0042698	ovulation cycle	ERBB2,BCL2,VEGFA,	9.61E-2
GO:0009314	response to radiation	BCL2,CASP7,KRT14,CASP3,	9.63E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value