错误信息提示:
错误号：12142

错误原因：Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句：
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-129' and taxid like '9606'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
  • Functional analysis
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-129
MI0000252 MIPF0000073 GGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUAGUCAGGAAGCCCUUACCCCAAAAAGUAUCU MIMAT0004548

hsa-miR-129-1-3p 		AAGCCCUUACCCCAAAAAGUAU This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000473) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (this entry) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (MIR:MI0000585) .
MI0000473 MIPF0000073 UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG MIMAT0000242

hsa-miR-129-5p 		CUUUUUGCGGUCUGGGCUUGC This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (MIR:MI0000222) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (this entry) .
MI0000473 MIPF0000073 UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG MIMAT0004605

hsa-miR-129-2-3p 		AAGCCCUUACCCCAAAAAGCAU This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (MIR:MI0000222) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (this entry) .
MI0000252 MIPF0000073 GGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUAGUCAGGAAGCCCUUACCCCAAAAAGUAUCU MIMAT0004548

hsa-miR-129-1-3p 		AAGCCCUUACCCCAAAAAGUAU This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000473) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (this entry) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (MIR:MI0000585) .
MI0000473 MIPF0000073 UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG MIMAT0000242

hsa-miR-129-5p 		CUUUUUGCGGUCUGGGCUUGC This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (MIR:MI0000222) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (this entry) .
MI0000473 MIPF0000073 UGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCG MIMAT0004605

hsa-miR-129-2-3p 		AAGCCCUUACCCCAAAAAGCAU This miRNA sequence was predicted based on homology to a verified miRNAcloned from mouse cerebellum . Expression of this miRNA wassubsequently verified in a human osteoblast sarcoma cell line .Reference named the human/mouse conserved sequence miR-129b, butsubsequent genome searches suggest that the same mature sequence may beexpressed from two predicted hairpin precursors in both human (this entryand MIR:MI0000252) and mouse (MIR:MI0000222 and MIR:MI0000585). Landgrafet al. show that the 5' product of mir-129-1 (MIR:MI0000222) is thepredominant one, whereas both 5' and 3' products are significantlyexpressed from mir-129-2 (this entry) .
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase
GALNT1,BMPR2,FMR1,SOX4,BCL2,CCP110,TUT1,UBE2F,ETV6,HIST1H2BJ,NOTCH1,UNG
more » GALNT1,BMPR2,FMR1,SOX4,BCL2,CCP110,TUT1,UBE2F,ETV6,HIST1H2BJ,NOTCH1,UNG
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
hsa04320 Dorso-ventral axis formation ETV6,NOTCH1, 3.39E-1
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
GO:0002320 lymphoid progenitor cell differentiation BCL2,SOX4, 5.16E-2
GO:0048729 tissue morphogenesis BMPR2,BCL2,NOTCH1, 7.38E-2
GO:0002244 hemopoietic progenitor cell differentiation BCL2,SOX4, 8.10E-2
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value