ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

hsa-miR-34c-5p

MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

XIAP,CDK6,SOX2,HNF4A,ULBP2,MYB,CCND1,E2F3,AXL,MAPT,NOTCH4,SRSF2,CDK4,BMF,MYCN
more » XIAP,CDK6,SOX2,HNF4A,ULBP2,MYB,CCND1,E2F3,AXL,MAPT,NOTCH4,SRSF2,CDK4,BMF,MYCN,PARK2,SIRT1,BIRC5,ZAP70,PARK7,ATG9A,GAS1,MYC,NOTCH1,UNG,ACSL1,CAV1,NANOG,CDK4PS,BCL2,CCNE2,MET

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05222	Small cell lung cancer	CCND1,CDK6,CCNE2,BCL2,CDK4,XIAP,E2F3,MYC,	3.63E-8
hsa05200	Pathways in cancer	CCND1,CDK6,CCNE2,BCL2,BIRC5,CDK4,XIAP,MET,E2F3,MYC,	4.07E-6
hsa04110	Cell cycle	CCND1,CDK6,CCNE2,CDK4,E2F3,MYC,	1.55E-4
hsa05218	Melanoma	CCND1,CDK6,CDK4,MET,E2F3,	2.11E-4
hsa05220	Chronic myeloid leukemia	CCND1,CDK6,CDK4,E2F3,MYC,	2.61E-4

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0042127	regulation of cell proliferation	GAS1,CCND1,ZAP70,SOX2,NOTCH4,BCL2,NOTCH1,CDK4,CAV1,E2F3,CDK6,MYCN,HNF4A,MYC,SIRT1,	4.76E-10
GO:0008284	positive regulation of cell proliferation	ZAP70,SOX2,CCND1,GAS1,CDK6,BCL2,NOTCH4,MYCN,NOTCH1,CDK4,E2F3,MYC,	9.42E-10
GO:0009991	response to extracellular stimulus	SOX2,CCND1,ACSL1,BCL2,AXL,CAV1,SIRT1,ATG9A,	5.15E-7
GO:0051726	regulation of cell cycle	CCND1,GAS1,CDK6,CCNE2,HNF4A,BCL2,BIRC5,CDK4,MYC,	5.69E-7
GO:0031667	response to nutrient levels	SOX2,CCND1,ACSL1,BCL2,CAV1,SIRT1,ATG9A,	4.80E-6

GO:0045596	negative regulation of cell differentiation	SOX2,CCND1,CDK6,NOTCH4,NOTCH1,CAV1,SIRT1,	8.15E-6
GO:0007346	regulation of mitotic cell cycle	CCND1,GAS1,HNF4A,BCL2,BIRC5,MYC,	2.25E-5
GO:0030856	regulation of epithelial cell differentiation	CCND1,NOTCH4,NOTCH1,CAV1,	3.82E-5
GO:0051329	interphase of mitotic cell cycle	CCND1,CDK6,BCL2,BIRC5,CDK4,	8.51E-5
GO:0010604	positive regulation of macromolecule metabolic process	SOX2,CCND1,HNF4A,BCL2,NOTCH4,NOTCH1,CDK4,CAV1,E2F3,MYC,	8.93E-5
GO:0051325	interphase	CCND1,CDK6,BCL2,BIRC5,CDK4,	9.52E-5
GO:0009968	negative regulation of signal transduction	SOX2,CCND1,GAS1,HNF4A,CAV1,SIRT1,	1.33E-4
GO:0030857	negative regulation of epithelial cell differentiation	CCND1,NOTCH4,CAV1,	1.41E-4
GO:0010648	negative regulation of cell communication	SOX2,CCND1,GAS1,HNF4A,CAV1,SIRT1,	2.28E-4
GO:0048732	gland development	SOX2,BCL2,NOTCH4,CAV1,MET,	2.42E-4
GO:0045165	cell fate commitment	SOX2,GAS1,BCL2,NOTCH4,NOTCH1,	2.70E-4
GO:0007049	cell cycle	CCND1,GAS1,CDK6,CCNE2,BCL2,BIRC5,CDK4,E2F3,MYC,	2.73E-4
GO:0007584	response to nutrient	SOX2,CCND1,ACSL1,BCL2,CAV1,	2.78E-4
GO:0031668	cellular response to extracellular stimulus	AXL,CAV1,SIRT1,ATG9A,	4.12E-4
GO:0048754	branching morphogenesis of a tube	BCL2,NOTCH4,MYCN,NOTCH1,	4.32E-4
GO:0051301	cell division	CCND1,CDK6,CCNE2,NOTCH1,BIRC5,CDK4,	5.08E-4
GO:0010720	positive regulation of cell development	SOX2,BCL2,MAPT,NOTCH1,	5.15E-4
GO:0031099	regeneration	CCND1,BCL2,AXL,NOTCH1,	5.15E-4
GO:0001763	morphogenesis of a branching structure	BCL2,NOTCH4,MYCN,NOTCH1,	6.32E-4
GO:0045786	negative regulation of cell cycle	GAS1,CDK6,HNF4A,BCL2,	8.23E-4
GO:0045930	negative regulation of mitotic cell cycle	GAS1,HNF4A,BCL2,	1.14E-2
GO:0043583	ear development	SOX2,GAS1,BCL2,MYC,	1.30E-2
GO:0042493	response to drug	CCND1,PARK7,ACSL1,BCL2,CAV1,	1.41E-2
GO:0022402	cell cycle process	CCND1,GAS1,CDK6,BCL2,BIRC5,CDK4,MYC,	1.55E-2
GO:0033554	cellular response to stress	CCND1,BCL2,UNG,CAV1,XIAP,SIRT1,ATG9A,	1.57E-2
GO:0045597	positive regulation of cell differentiation	ZAP70,SOX2,BCL2,MAPT,NOTCH1,	1.75E-2
GO:0042981	regulation of apoptosis	GAS1,BCL2,NOTCH1,BIRC5,XIAP,SIRT1,MYC,BMF,	1.90E-2
GO:0043067	regulation of programmed cell death	GAS1,BCL2,NOTCH1,BIRC5,XIAP,SIRT1,MYC,BMF,	2.02E-2
GO:0010941	regulation of cell death	GAS1,BCL2,NOTCH1,BIRC5,XIAP,SIRT1,MYC,BMF,	2.06E-2
GO:0032844	regulation of homeostatic process	CDK6,BCL2,CAV1,MYC,	2.20E-2
GO:0012501	programmed cell death	GAS1,BCL2,BIRC5,XIAP,SIRT1,MYC,BMF,	2.31E-2
GO:0009267	cellular response to starvation	CAV1,SIRT1,ATG9A,	2.41E-2
GO:0035239	tube morphogenesis	BCL2,NOTCH4,MYCN,NOTCH1,	2.99E-2
GO:0045137	development of primary sexual characteristics	SOX2,CCND1,BCL2,SIRT1,	2.99E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	3.25E-2
GO:0045664	regulation of neuron differentiation	SOX2,BCL2,MAPT,NOTCH1,	3.41E-2
GO:0002520	immune system development	ZAP70,CDK6,BCL2,NOTCH4,UNG,	3.45E-2
GO:0051094	positive regulation of developmental process	ZAP70,SOX2,BCL2,MAPT,NOTCH1,	3.54E-2
GO:0006468	protein amino acid phosphorylation	ZAP70,CCND1,CDK6,BCL2,AXL,CDK4,MET,	3.59E-2
GO:0042325	regulation of phosphorylation	CCND1,CCNE2,HNF4A,BCL2,CAV1,MET,	3.84E-2
GO:0031328	positive regulation of cellular biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	4.09E-2
GO:0042594	response to starvation	CAV1,SIRT1,ATG9A,	4.13E-2
GO:0045893	positive regulation of transcription, DNA-dependent	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	4.24E-2
GO:0051899	membrane depolarization	PARK7,BCL2,CAV1,	4.32E-2
GO:0009891	positive regulation of biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	4.39E-2
GO:0051254	positive regulation of RNA metabolic process	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	4.40E-2
GO:0031669	cellular response to nutrient levels	CAV1,SIRT1,ATG9A,	4.52E-2
GO:0019220	regulation of phosphate metabolic process	CCND1,CCNE2,HNF4A,BCL2,CAV1,MET,	4.55E-2
GO:0051174	regulation of phosphorus metabolic process	CCND1,CCNE2,HNF4A,BCL2,CAV1,MET,	4.55E-2
GO:0051583	dopamine uptake	PARK7,PARK2,	4.57E-2
GO:0051934	catecholamine uptake during transmission of nerve impulse	PARK7,PARK2,	4.57E-2
GO:0006355	regulation of transcription, DNA-dependent	SOX2,MYB,HNF4A,NOTCH4,MYCN,ATF1,NANOG,NOTCH1,E2F3,SIRT1,MYC,	4.74E-2
GO:0007548	sex differentiation	SOX2,CCND1,BCL2,SIRT1,	4.87E-2
GO:0008219	cell death	GAS1,BCL2,BIRC5,XIAP,SIRT1,MYC,BMF,	5.19E-2
GO:0016265	death	GAS1,BCL2,BIRC5,XIAP,SIRT1,MYC,BMF,	5.37E-2
GO:0051252	regulation of RNA metabolic process	SOX2,MYB,HNF4A,NOTCH4,MYCN,ATF1,NANOG,NOTCH1,E2F3,SIRT1,MYC,	5.57E-2
GO:0019217	regulation of fatty acid metabolic process	ACSL1,HNF4A,CAV1,	5.58E-2
GO:0050767	regulation of neurogenesis	SOX2,BCL2,MAPT,NOTCH1,	6.33E-2
GO:0042524	negative regulation of tyrosine phosphorylation of Stat5 protein	HNF4A,CAV1,	6.85E-2
GO:0001932	regulation of protein amino acid phosphorylation	CCND1,HNF4A,BCL2,CAV1,	7.10E-2
GO:0009612	response to mechanical stimulus	SOX2,CAV1,MYC,	7.24E-2
GO:0000082	G1/S transition of mitotic cell cycle	CCND1,BCL2,CDK4,	7.24E-2
GO:0010565	regulation of cellular ketone metabolic process	ACSL1,HNF4A,CAV1,	7.49E-2
GO:0050769	positive regulation of neurogenesis	SOX2,MAPT,NOTCH1,	8.01E-2
GO:0010212	response to ionizing radiation	CCND1,BCL2,CAV1,	8.28E-2
GO:0043066	negative regulation of apoptosis	BCL2,NOTCH1,BIRC5,XIAP,MYC,	8.30E-2
GO:0045941	positive regulation of transcription	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	8.55E-2
GO:0016310	phosphorylation	ZAP70,CCND1,CDK6,BCL2,AXL,CDK4,MET,	8.66E-2
GO:0043069	negative regulation of programmed cell death	BCL2,NOTCH1,BIRC5,XIAP,MYC,	8.71E-2
GO:0060548	negative regulation of cell death	BCL2,NOTCH1,BIRC5,XIAP,MYC,	8.79E-2
GO:0008285	negative regulation of cell proliferation	GAS1,CDK6,HNF4A,BCL2,CAV1,	8.88E-2
GO:0030879	mammary gland development	NOTCH4,CAV1,MET,	9.09E-2
GO:0051960	regulation of nervous system development	SOX2,BCL2,MAPT,NOTCH1,	9.44E-2
GO:0009628	response to abiotic stimulus	SOX2,CCND1,BCL2,CAV1,MYC,	9.48E-2
GO:0046546	development of primary male sexual characteristics	SOX2,CCND1,BCL2,	9.66E-2
GO:0010628	positive regulation of gene expression	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	9.66E-2
GO:0000278	mitotic cell cycle	CCND1,CDK6,BCL2,BIRC5,CDK4,	9.66E-2
GO:0033273	response to vitamin	SOX2,CCND1,BCL2,	9.95E-2
GO:0042471	ear morphogenesis	SOX2,GAS1,MYC,	9.95E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value