ncRNADetailInformation

Detail Information

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

hsa-miR-30a

MI0000088	MIPF0000005	GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC	MIMAT0000087 hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG	The mature sequences miR-30 and miR-97 appear to originate fromthe same precursor. Subsequent data confirm that both arms of theprecursor appear to give rise to mature miRNA sequences (Pfeffer S, pers.comm.). Landgraf et al. later showed that the 5' product is thepredominant one . Related miRNAs are processed from the 5' arms ofother precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736;mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
MI0000088	MIPF0000005	GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC	MIMAT0000087 hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG	The mature sequences miR-30 and miR-97 appear to originate fromthe same precursor. Subsequent data confirm that both arms of theprecursor appear to give rise to mature miRNA sequences (Pfeffer S, pers.comm.). Landgraf et al. later showed that the 5' product is thepredominant one . Related miRNAs are processed from the 5' arms ofother precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736;mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
MI0000088	MIPF0000005	GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC	MIMAT0000087 hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG	The mature sequences miR-30 and miR-97 appear to originate fromthe same precursor. Subsequent data confirm that both arms of theprecursor appear to give rise to mature miRNA sequences (Pfeffer S, pers.comm.). Landgraf et al. later showed that the 5' product is thepredominant one . Related miRNAs are processed from the 5' arms ofother precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736;mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
MI0000088	MIPF0000005	GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC	MIMAT0000087 hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG	The mature sequences miR-30 and miR-97 appear to originate fromthe same precursor. Subsequent data confirm that both arms of theprecursor appear to give rise to mature miRNA sequences (Pfeffer S, pers.comm.). Landgraf et al. later showed that the 5' product is thepredominant one . Related miRNAs are processed from the 5' arms ofother precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736;mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).
MI0000088	MIPF0000005	GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUGUUUGCAGCUGC	MIMAT0000087 hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG	The mature sequences miR-30 and miR-97 appear to originate fromthe same precursor. Subsequent data confirm that both arms of theprecursor appear to give rise to mature miRNA sequences (Pfeffer S, pers.comm.). Landgraf et al. later showed that the 5' product is thepredominant one . Related miRNAs are processed from the 5' arms ofother precursor loci (mir-30b, MIR:MI0000441; mir-30c-1, MIR:MI0000736;mir-30c-2, MIR:MI0000254; mir-30d, MIR:MI0000255; mir-30e, MI0000749).

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value