The Detail Information for This Interaction


  • Detail
  • Binding
  • Network
Detail-Interactions:
RAID ID: RRI00000232
RNA/Protein Symbol 1:MIR21
RNA/Protein Category 1: miRNA
RNA/Protein Symbol 2: SERPINB5 mRNA
RNA/Protein Category 2: mRNA
Validated Method: Luciferase reporter assay, Western blot
Tissue: 293T cells 
PMID: 18270520 
Detail description:

PDCD4 and maspin are direct mir-21 targets//We tested the effect of mir-21 on luciferase activity for each construct in 293T cells that express a low level of mir-21. As shown in Figure 5B, mir-21 suppressed the luciferase activity of the Luc-PDCD4 3`-UTR by more than 50% compared with the vector control,whereas deletion of the mir-21 binding site (underlined in Figure 5A) blocked this suppression (Figure 5B). Similarly, mir-21 also suppressed the luciferase activity of the LucMaspin 3`-UTR by more than 40% compared with the vector control (Figure 5B), and deletion of the mir-21 binding site (underlined) reversed this suppression. 

The Predicated Binding Sites between MIR21 and SERPINB5
By miRanda Structure Match Score Energy Score MIR21 Location SERPINB5 Location 
   Query:    3' agUUGUAGUCAGACUAUUCGAu 5'
                  || :|::||: |||||||| 
   Ref:      5' guAAAGUUGGUUGGAUAAGCUa 3'
168.00 -17.38 2-21 1165-1186 
   Query:    3' agUUGUAGUCAGACUAUUCGAu 5'
                  | || ||  :| ||| ||| 
   Ref:      5' aaAUCAACACCUUAAUAUGCUg 3'
124.00 -9.27 2-21 636-657 
   Query:    3' aguuguAGUCAGACUAUUCGAu 5'
                      ||||||| ||::|:| 
   Ref:      5' aguuuuUCAGUCU-AUGGGUUu 3'
118.00 -15.18 2-17 1099-1119
The Predicated Binding Sites between MIR21 and SERPINB5
By RIsearch Structure MIR21 Location SERPINB5 Location Score 
Query:    3' UAGCUUAUCAGACUGAUGUUG 5'
          ||||||||| :||::|: ||:
Target:   5' AUCGAAUAGGUUGGUUGAAAU 3'
1-21 1166-1186 -17.81
The Predicated Binding Sites of SERPINB5
RBPBD 

					

					

						RsiteDB
						
					

						BindN
						
							 

								
					

					

						BindN+
						
							 

								
					

					

					    RNAbindR
						
                              
	 
								
					

					

					    Pprint
						
                            

								
					



				 
	
            			
	

	
    
	
	  
	 

      

	  
Visualization:
	  
	  

	  Select the center nodes:
	   First Node
	   Second Node
	  Both the Nodes	
 
      
Select the Level of Neighbour:
	   First Neighbour
	   Second Neighbour  
	  

	        
	  

	 
	 
	


 
	 

	  The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
	  the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes. 
	  
The 'First Neighbour' represents the sub-network of direct interacting with the center node, 
	  the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node. 
	  Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
	 


	  

	   
	
	

  





	

		

           			
				
	
                   The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
 
				   The Binding page: representing the predicted binding sites and/or constants.
 
				   The Network page: representing the interaction sub-network of interacting RNA/Protein.