Detail-Interactions: | |
RAID ID: | RRI00000122 |
---|---|
RNA/Protein Symbol 1: | HOTAIR |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | HOXD8 mRNA |
RNA/Protein Category 2: | mRNA |
Validated Method: | Immunoprecipitation, RT-PCR |
Tissue: | |
PMID: | 17604720 |
Detail description: | HOTAIR ncRNA may regulate gene expression in HOX loci in cis or trans; alternatively, it may be the act of antisense transcription in the HOXC locus rather than the ncRNA itself that has a functional role in gene regulation. depletion of HOTAIR lead to dramatic transcriptional activation of the HOXD locus on chromosome 2 spanning over 40 Kb, including HOXD8, HOXD9, HOXD10, HOXD11, and multiple ncRNAs (Fig. 5a, b, Supplementary Fig. 7). |
The Predicated Binding Sites between HOTAIR and HOXD8 | |||||
By miRanda | Structure | Match Score | Energy Score | HOTAIR Location | HOXD8 Location |
The Predicated Binding Sites between HOTAIR and HOXD8 | ||||
By RIsearch | Structure | HOTAIR Location | HOXD8 Location | Score |
Query: 3' GGUGGUUUUAUGCAUAAAUAAAGUUUUACAUGUGGUGAAU 5' ||:|: |||| |: ::||| |:: || |: Target: 5' CCGCUC-----CGUAA---AAGCGUGGUGU-CGUGACGUG 3' |
2320-2359 | 4-34 | -11.13 | |
The Predicated Binding Sites of HOXD8 | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.