Detail-Interactions: | |
RAID ID: | RRI00000014 |
---|---|
RNA/Protein Symbol 1: | CDK4PS |
RNA/Protein Category 1: | lncRNA |
RNA/Protein Symbol 2: | MIR34B(miR-34b) |
RNA/Protein Category 2: | miRNA |
Validated Method: | Dual Luciferase reporter assay, RT-PCR |
Tissue: | |
PMID: | 20577206 |
Detail description: | Further examples of such conservation include: miR-34 family binding site on CDK4PS (Supplementary Fig. 12); miR-182 binding site on FOXO3B (Supplementary Fig. 13); miR-17 family binding site on E2F3P1 (Supplementary Fig. 14); miR-143 and let-7 family binding sites on KRAS1P (Supplementary Fig. 15). |
The Predicated Binding Sites between MIR34B and CDK4PS | |||||
By miRanda | Structure | Match Score | Energy Score | MIR34B Location | CDK4PS Location |
Query: 3' guuAGUCGAUUACUGUGACGGAu 5' | | ||:|| : :|||||| Ref: 5' cuuUAACCUGAUUGGGCUGCCUc 3' |
144.00 | -15.48 | 2-21 | 723-745 | |
Query: 3' guuaguCGAU-UACUGUGACGGAu 5' |||: | || |||| || Ref: 5' uaugguGCUGCAAGA-ACUGGCUc 3' |
118.00 | -11.86 | 2-18 | 14-36 | |
Query: 3' guuagucgaUUA-CUGUGACGGau 5' ||| || :||||| Ref: 5' cacagaaggAAUAGAAGCUGCCau 3' |
117.00 | -15.07 | 3-15 | 952-975 |
The Predicated Binding Sites between MIR34B and CDK4PS | ||||
By RIsearch | Structure | MIR34B Location | CDK4PS Location | Score |
Query: 3' UAGGCAGUGUCAUUAGCUGAUUG 5' :||||| :|:||:|| Target: 5' GUCCGUG-------GUGGCUGAC 3' |
1-23 | 817-832 | -15.73 |
The Predicated Binding Sites of CDK4PS | |
RBPBD | |
RsiteDB | |
BindN | |
BindN+ | |
RNAbindR | |
Pprint |
The 'First Node' or 'Second Node' option represents the sub-network of interacting RNA/Protein with the first or second interaction node,
the 'Both the Nodes' option represents the sub-network of interacting RNA/Protein with both of interaction nodes.
The 'First Neighbour' represents the sub-network of direct interacting with the center node,
the 'Second Neighbour' represents the sub-network of direct or second step interacting with the center node.
Interaction sub-network based on the two nodes of this interaction may help the researchers represents all interacting partners immediately.
The Detail page: representing the detail information for RNA-RNA/RNA-Protein interaction;
The Binding page: representing the predicted binding sites and/or constants.
The Network page: representing the interaction sub-network of interacting RNA/Protein.