Detail Information

Basic Information:


  VIRBase ID:  

HVID00010649

  Virus:  

SARS-CoV-2 (NC_045512.2)

  Host:  

Homo sapiens

  Confidence Score:  

0.2381

  Interaction Type:  

Host-Virus interaction

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-12119 N
miRBase
Accession/Entrez ID		 MIMAT0049013 43740575
Organism Homo sapiens SARS-CoV-2 (NC_045512.2)
Category miRNA mRNA
Alias - GU280_gp10

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-12119
rs1022328368 chr7:99409199    G/T
rs1033766342 chr7:99409196    G/T
rs1298269453 chr7:99409198    C/T
rs35842908 chr7:99409210    G/A
rs529299106 chr7:99409202    A/C
rs544580647 chr7:99409207    T/C
rs1217373031 chr7:99409187    TTCTGAGGGGACGGTAGATTTGGGGGTTTTCC/T
rs138620687 chr7:99409189    C/G
rs781429112 chr7:99409176    CACGTTCGTTCTTCTGAGGGG/C

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-12119
Interactor2: N

Evidence Support:


Prediction-Evidence IntaRNA//miRanda//psRNATarget
Support Database ViRBase

References:


[1]PMID 32765592 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description From our rigorous analysis pipeline, which covers three different well-established algorithms (IntaRNA, miRanda, and psRNATarget) to predict RNA-RNA interactions, we have identified 122 and 106 host antiviral miRNAs against SARS-CoV (R) and SARS-CoV-2 (R), respectively (Figures 2A,B, Supplementary File 2).
[2]PMID 33251388 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description Among the 2654 human mature miRNAs, 444 miRNAs were identified with direct binding site on different positions along with the coronavirus 2 reference genome (Table S1).
[3]PMID 33173539 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description We identified 1,018 miRNAs to target SARS-CoV-2 genes, among which 98 miRNAs are predicted to target SARS-CoV-2 genes uniquely when compared with other viruses studied here (Supplementary Table S6).

Starting a new search, please wait ...