Detail Information

Basic Information:


  VIRBase ID:  

HVID00008034

  Virus:  

SARS coronavirus Tor2

  Host:  

Homo sapiens

  Confidence Score:  

0.2455

  Interaction Type:  

Host-Virus interaction

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-6514-3p ORF1ab
miRBase
Accession/Entrez ID		 MIMAT0025485 1489680
Organism Homo sapiens SARS coronavirus Tor2
Category miRNA mRNA
Alias - sarsp1

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-6514-3p
rs1340624440 chr11:62792706    A/G
rs1451188899 chr11:62792722    G/A
rs369105346 chr11:62792705    G/C
rs369105346 chr11:62792705    G/T
rs372996716 chr11:62792704    G/A
rs1256709397 chr11:62792716    C/T
rs370306415 chr11:62792719    G/C
rs758662879 chr11:62792719    GCAGCTCTGTAAGAACTCTGACTCGTAAATGC/G

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-6514-3p
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Cell lines(GBM46|GBM8|HaCaT|K562|MCF-10A|MCF-7|MGG75)|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocytes     -

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-6514-3p
Interactor2: ORF1ab

Evidence Support:


Prediction-Evidence IntaRNA//miRanda//miRTarP//psRNATarget
Support Database ViRBase

References:


[1]PMID 33173539 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description Interestingly, we observed that 717 miRNAs targeting SARS-CoV-2 genes are common with those targeting SARS-CoV genes, possibly due to high genome similarity (Xu et al., 2020; Zhang and Holmes, 2020, p. 2) (Supplementary Table S7).
[2]PMID 32765592 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description From our rigorous analysis pipeline, which covers three different well-established algorithms (IntaRNA, miRanda, and psRNATarget) to predict RNA-RNA interactions, we have identified 122 and 106 host antiviral miRNAs against SARS-CoV (R) and SARS-CoV-2 (R), respectively (Figures 2A,B, Supplementary File 2).

Starting a new search, please wait ...