Detail Information

Basic Information:


  VIRBase ID:  

HVID00007396

  Virus:  

SARS coronavirus Tor2

  Host:  

Homo sapiens

  Confidence Score:  

0.1828

  Interaction Type:  

Host-Virus interaction

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-4489 E
miRBase
Accession/Entrez ID		 MIMAT0019023 1489671
Organism Homo sapiens SARS coronavirus Tor2
Category miRNA mRNA
Alias - sars4

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-4489
rs1000581449 chr11:65649197    T/C
rs1000581449 chr11:65649197    T/G
rs1039131734 chr11:65649217    G/A
rs1402780321 chr11:65649205    G/C
rs1444871791 chr11:65649206    TGATGCAGGACGCTGGGGACTGGA/T
rs542936239 chr11:65649215    A/G
rs952071485 chr11:65649216    C/T
rs1464390497 chr11:65649204    A/C
rs573571324 chr11:65649203    T/C

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-4489
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Cell lines(GBM46|GBM8|HaCaT|K562|MCF-10A|MCF-7|MGG75)|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocytes     -

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-4489
Interactor2: E

Evidence Support:


Prediction-Evidence miRTarP
Support Database ViRBase

References:


PMID 33173539 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description Interestingly, we observed that 717 miRNAs targeting SARS-CoV-2 genes are common with those targeting SARS-CoV genes, possibly due to high genome similarity (Xu et al., 2020; Zhang and Holmes, 2020, p. 2) (Supplementary Table S7).

Starting a new search, please wait ...