Detail Information

Basic Information:


  VIRBase ID:  

HHID00105273

  Virus:  

SARS-CoV-2

  Host:  

Homo sapiens

  Confidence Score:  

0.2494

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-579-3p:           TMPRSS2:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-579-3p TMPRSS2
miRBase
Accession/Entrez ID
MIMAT0003244 7113
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - PRSS10

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-579-3p
rs1165224671 chr5:32394404    T/C
rs1190752232 chr5:32394395    C/T
rs1404190650 chr5:32394401    T/C
rs1412824363 chr5:32394357    AAAGACCATAGACTGTAGTAAGTTGATGCAAAAATAATCGCGG/A
rs1415619084 chr5:32394406    C/T
rs376231726 chr5:32394397    C/T
rs768681140 chr5:32394396    G/A
rs939936972 chr5:32394398    G/A
rs1487016067 chr5:32394410    A/T

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR TMPRSS2
chr21:42853862(-) A-I      intronic
chr21:42853848(-) A-I      intronic
chr21:42853888(-) A-I      intronic
chr21:42853850(-) A-I      intronic
chr21:42853879(-) A-I      intronic
chr21:42857482(-) A-I      intronic
chr21:42857493(-) A-I      intronic
chr21:42857494(-) A-I      intronic
chr21:42857532(-) A-I      intronic
chr21:42861840(-) A-I      intronic
chr21:42863176(-) A-I      intronic
chr21:42863181(-) A-I      intronic
chr21:42864020(-) A-I      intronic
chr21:42857454(-) A-I      intronic
chr21:42852821(-) A-I      intronic
chr21:42852811(-) A-I      intronic
chr21:42868840(-) A-I      intronic
chr21:42864037(-) A-I      intronic
chr21:42852802(-) A-I      intronic
chr21:42852784(-) A-I      intronic
chr21:42852783(-) A-I      intronic
chr21:42852698(-) A-I      intronic
chr21:42868853(-) A-I      intronic
chr21:42853773(-) A-I      intronic
chr21:42853747(-) A-I      intronic
chr21:42852838(-) A-I      intronic
chr21:42868879(-) A-I      intronic
chr21:42853786(-) A-I      intronic
chr21:42853787(-) A-I      intronic
chr21:42853866(-) A-I      intronic
chr21:42853876(-) A-I      intronic
chr21:42853901(-) A-I      intronic
chr21:42853902(-) A-I      intronic
chr21:42853905(-) A-I      intronic
chr21:42853936(-) A-I      intronic
chr21:42857436(-) A-I      intronic
chr21:42852837(-) A-I      intronic
chr21:42852694(-) A-I      intronic
chr21:42857467(-) A-I      intronic
chr21:42857468(-) A-I      intronic
chr21:42857476(-) A-I      intronic
chr21:42859902(-) A-I      ncRNA
chr21:42859884(-) A-I      ncRNA
chr21:42859893(-) A-I      ncRNA
chr21:42868835(-) A-I      intronic
chr21:42859992(-) A-I      intronic
chr21:42855936(-) A-I      intronic
chr21:42868944(-) A-I      intronic
chr21:42868836(-) A-I      intronic
chr21:42852668(-) A-I      intronic
chr21:42859993(-) A-I      intronic
chr21:42869010(-) A-I      intronic
chr21:42863353(-) A-I      intronic
chr21:42868900(-) A-I      intronic
chr21:42868945(-) A-I      intronic
chr21:42852703(-) A-I      intronic
chr21:42860827(-) A-I      intronic
chr21:42859858(-) A-I      ncRNA
chr21:42859831(-) A-I      ncRNA
chr21:42859844(-) A-I      ncRNA
chr21:42858403(-) A-I      ncRNA
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED TMPRSS2
chr21:42858403(-) A-I intron -    15342557
chr21:42858406(-) A-I intron -    15342557
chr21:42859670(-) A-I intron -    15342557
chr21:42859831(-) A-I intron -    15342557   //15258596
chr21:42859844(-) A-I intron -    15342557   //15258596
chr21:42859858(-) A-I intron -    15342557   //15258596
chr21:42859884(-) A-I intron -    15342557   //15258596
chr21:42859893(-) A-I intron -    15342557   //15258596
chr21:42859902(-) A-I intron -    15342557   //15258596
chr21:42868835(-) A-I intron -    15342557
chr21:42868836(-) A-I intron -    15342557
chr21:42868864(-) A-I intron -    15342557
chr21:42868900(-) A-I intron -    15342557
chr21:42868905(-) A-I intron -    15342557
chr21:42868944(-) A-I intron -    15342557
chr21:42868945(-) A-I intron -    15342557
chr21:42868950(-) A-I intron -    15342557
chr21:42869010(-) A-I intron -    15342557
chr21:42869014(-) A-I intron -    15342557
chr21:42869073(-) A-I intron -    15342557
chr21:42853823(-) A-I intron -    21960545
chr21:42853826(-) A-I intron -    21960545
chr21:42853866(-) A-I intron -    21960545
chr21:42855839(-) A-I intron -    21960545
chr21:42855936(-) A-I intron -    21960545
chr21:42855984(-) A-I intron -    21960545
chr21:42857419(-) A-I intron -    21960545
chr21:42857454(-) A-I intron -    21960545
chr21:42857468(-) A-I intron -    21960545
chr21:42857493(-) A-I intron -    21960545

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase TMPRSS2
chr21:42836773-42836774(-) m6A 3'UTR       25456834

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-579-3p
Exosome Lung adenocarcinoma epithelial cell line (A549)     20615901
Exosome Plasma     24683445
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Lung epithelial carcinoma cell line (A549)     20615901
Microvesicle Fibroblasts|Mesenchymal stem cells     -
TMPRSS2
Exosome Blood     -
Nucleus HCC cell line (HepG2)     -
Ribosome Colon cancer cells     24393600

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-579-3p
Interactor2: TMPRSS2

Evidence Support:


Prediction-Evidence microT//miRanda//miRMap//PicTar//PITA//Targetscan
Support Database ViRBase

References:


PMID 33428154 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line None Interactor2 expression None
Description To explore the regulatory relationship between the 5 key genes, 3 coronavirus-related genes (ACE2, TMPRSS2, BSG), and their target miRNA, we used 6 miRNA target prediction databases to predict the target miRNA of these genes.

Starting a new search, please wait ...