Detail Information

Basic Information:


  VIRBase ID:  

HHID00074587

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-3928-3p:           LNPEP:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-3928-3p LNPEP
miRBase
Accession/Entrez ID
MIMAT0018205 4012
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - CAP//IRAP//P-LAP//PLAP

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-3928-3p
rs1005500306 chr22:31160075    G/A
rs1459321820 chr22:31160064    C/G
rs368833031 chr22:31160071    C/CTTTGA
rs60197191 chr22:31160064    C/CAAAGCTCTTTGAAAAGCTGCG
rs879134097 chr22:31160065    G/A
rs879163389 chr22:31160062    G/C
rs890609194 chr22:31160068    G/A
rs908683590 chr22:31160069    C/A
rs940282100 chr22:31160073    A/G
rs1274136392 chr22:31160081    T/C
rs1342810760 chr22:31160076    G/A

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR LNPEP
chr5:96291326(+) A-I      intronic
chr5:96291324(+) A-I      intronic
chr5:96291244(+) A-I      intronic
chr5:96291055(+) A-I      intronic
chr5:96290762(+) A-I      intronic
chr5:96290760(+) A-I      intronic
chr5:96290748(+) A-I      intronic
chr5:96290747(+) A-I      intronic
chr5:96290693(+) A-I      intronic
chr5:96290685(+) A-I      intronic
chr5:96290626(+) A-I      intronic
chr5:96280312(+) A-I      intronic
chr5:96279025(+) A-I      intronic
chr5:96278148(+) A-I      intronic
chr5:96290671(+) A-I      intronic
chr5:96281029(+) A-I      intronic
chr5:96281089(+) A-I      intronic
chr5:96281090(+) A-I      intronic
chr5:96359087(+) A-I      intronic
chr5:96331488(+) A-I      intronic
chr5:96331372(+) A-I      intronic
chr5:96331264(+) A-I      intronic
chr5:96330744(+) A-I      intronic
chr5:96330732(+) A-I      intronic
chr5:96330697(+) A-I      intronic
chr5:96294296(+) A-I      5'UTR
chr5:96294312(+) A-I      5'UTR
chr5:96294314(+) A-I      5'UTR
chr5:96294343(+) A-I      5'UTR
chr5:96330683(+) A-I      intronic
chr5:96291064(+) A-I      intronic
chr5:96331326(+) A-I      intronic
chr5:96331491(+) A-I      intronic
chr5:96330626(+) A-I      intronic
chr5:96324588(+) A-I      intronic
chr5:96279065(+) A-I      intronic
chr5:96280377(+) A-I      intronic
chr5:96280373(+) A-I      intronic
chr5:96331362(+) A-I      intronic
chr5:96279174(+) A-I      intronic
chr5:96330559(+) A-I      intronic
chr5:96280837(+) A-I      intronic
chr5:96330737(+) A-I      intronic
chr5:96281055(+) A-I      intronic
chr5:96280366(+) A-I      intronic
chr5:96281016(+) A-I      intronic
chr5:96331284(+) A-I      intronic
chr5:96280839(+) A-I      intronic
chr5:96331427(+) A-I      intronic
chr5:96291143(+) A-I      intronic
chr5:96279253(+) A-I      intronic
chr5:96278100(+) A-I      intronic
chr5:96278273(+) A-I      intronic
chr5:96330757(+) A-I      intronic
chr5:96331307(+) A-I      intronic
chr5:96279191(+) A-I      intronic
chr5:96330558(+) A-I      intronic
chr5:96278247(+) A-I      intronic
chr5:96362964(+) A-I      intronic
chr5:96330550(+) A-I      intronic
chr5:96291154(+) A-I      intronic
chr5:96331380(+) A-I      intronic
chr5:96331416(+) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED LNPEP
chr5:96278247(+) A-G intron -    22484847
chr5:96278273(+) A-G intron -    22484847
chr5:96279065(+) A-G intron -    22484847
chr5:96279091(+) A-G intron -    22484847
chr5:96279174(+) A-G intron -    22484847
chr5:96279191(+) A-G intron -    22484847
chr5:96279200(+) A-G intron -    22484847
chr5:96280342(+) A-G intron -    22484847
chr5:96280366(+) A-G intron -    22484847
chr5:96280373(+) A-G intron -    22484847
chr5:96280376(+) A-G intron -    22484847
chr5:96280377(+) A-G intron -    22484847
chr5:96280478(+) A-G intron -    22484847
chr5:96280839(+) A-G intron -    22484847
chr5:96284089(+) T-C intron -    22484847
chr5:96291063(+) A-G intron -    22484847
chr5:96291064(+) A-G intron -    22484847
chr5:96291154(+) A-G intron -    22484847
chr5:96330558(+) A-G intron -    22484847
chr5:96330559(+) A-G intron -    22484847
chr5:96330626(+) A-G intron -    22484847
chr5:96330628(+) A-G intron -    22484847
chr5:96330683(+) A-G intron -    22484847
chr5:96330691(+) A-G intron -    22484847
chr5:96330692(+) A-G intron -    22484847
chr5:96330733(+) A-G intron -    22484847
chr5:96330737(+) A-G intron -    22484847
chr5:96330757(+) A-G intron -    22484847
chr5:96331284(+) A-G intron -    22484847
chr5:96331307(+) A-G intron -    22484847
chr5:96331326(+) A-G intron -    22484847
chr5:96331362(+) A-G intron -    22484847
chr5:96331416(+) A-G intron -    22484847
chr5:96337659(+) C-T intron -    22484847
chr5:96337700(+) T-C intron -    22484847
chr5:96357654(+) G-T intron -    22484847
chr5:96357728(+) T-C intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase LNPEP
chr5:96271123-96271124(+) m6A exon       24284625
chr5:96271191-96271192(+) m6A 5'UTR//exon       24284625//24981863
chr5:96271250-96271251(+) m6A 5'UTR//exon       24284625//24981863
chr5:96271427-96271428(+) m6A 5'UTR//intron       24284625//24981863//22608085
chr5:96271433-96271434(+) m6A 5'UTR//intron       24284625//25456834//24981863//22608085
chr5:96271519-96271520(+) m6A 5'UTR//intron       24284625//25456834//24981863//22608085
chr5:96271614-96271615(+) m6A 5'UTR//intron       24284625//24981863//22608085
chr5:96271708-96271709(+) m6A 5'UTR//exon       24284625
chr5:96271903-96271904(+) m6A exon//intron       24981863
chr5:96314874-96314875(+) m6A CDS       -
chr5:96314893-96314894(+) m6A CDS       -
chr5:96315090-96315091(+) m6A CDS       24284625//24209618//24981863//22575960//22608085
chr5:96315149-96315150(+) m6A CDS       24284625//24209618//24981863//22575960//22608085
chr5:96315255-96315256(+) m6A CDS       24284625//24209618//24981863//22575960//22608085
chr5:96315268-96315269(+) m6A CDS       24284625//24209618//24981863//22575960//22608085
chr5:96315355-96315356(+) m6A CDS       24284625//24209618//24981863//26404942//22575960//22608085
chr5:96315372-96315373(+) m6A CDS       24284625//24209618//24981863//26404942//22575960//22608085
chr5:96315511-96315512(+) m6A CDS       24284625//24209618//24981863//26404942//22608085
chr5:96315544-96315545(+) m6A CDS       24284625//24981863//26404942//22608085
chr5:96320807-96320808(+) m6A CDS       24284625
chr5:96364476-96364477(+) m6A 3'UTR       24284625//24209618//24981863//22608085
chr5:96364517-96364518(+) m6A 3'UTR       24284625//24981863//26404942//22608085
chr5:96364523-96364524(+) m6A 3'UTR       24284625//24981863//26404942//22608085
chr5:96364582-96364583(+) m6A 3'UTR       24284625//24981863//26404942//22575960//22608085
chr5:96364712-96364713(+) m6A 3'UTR       24284625//24981863//22575960//22608085
chr5:96364735-96364736(+) m6A 3'UTR       24284625//24981863//22608085
chr5:96365461-96365462(+) m6A 3'UTR       24981863
chr5:96365520-96365521(+) m6A 3'UTR       24981863
chr5:96372712-96372713(+) m6A 3'UTR       26404942

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-3928-3p
Exosome Plasma     23663360
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Fibroblasts|Mesenchymal stem cells     -
Mitochondrion Cell line (HEK-293|HeLa)     22984580
LNPEP
Chromatin K562 cells     -
Cytosol HCC cell line (HepG2)|K562 cells     -
Endoplasmic reticulum Human myelogenous leukemia cell line (K-562)     21613539
Exosome Blood     -
Membrane HCC cell line (HepG2)     -
Nucleolus K562 cells     -
Nucleoplasm K562 cells     -
Nucleus HeLa-S3 cells|K562 cells     -
Ribosome HEK-293 cells     22199352

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-3928-3p
Interactor2: LNPEP

Evidence Support:


Weak-Evidence PAR-CLIP
Support Database ViRBase

References:


PMID 22291592 Target region 3'UTR
Source ViRBase Interactor1 expression None
Tissue or cell line EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells Interactor2 expression None
Description We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.

Starting a new search, please wait ...