Basic Information:

  VIRBase ID:  

HHID00068793

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-320b:  MIMAT0005792          VASH2:  NM_024749     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-320b	VASH2
miRBase Accession/Entrez ID	MIMAT0005792	79805
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	-

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-320b	rs1156276707 chr1:116671796    G/T rs1311857670 chr1:116671805    GCAAA/G rs1373244526 chr1:116671806    C/T rs1434535374 chr1:116671803    G/C rs755613466 chr1:116671797    T/C rs779451916 chr1:116671801    G/C rs1303311077 chr1:224257059    A/T rs1313950455 chr1:224257062    C/A rs1333032274 chr1:224257051    G/T rs1445839645 chr1:224257055    T/C rs1465806287 chr1:224257050    TGCCC/T rs745315768 chr1:224257052    C/T rs769446888 chr1:224257054    C/T rs1189118293 chr1:116671788    A/G rs1199375375 chr1:116671794    G/A rs1411861918 chr1:116671791    G/T rs1469116635 chr1:116671792    C/CTGGGTTGAGAGGGCAAACAAATTAACTAAT rs1030808536 chr1:224257064    A/T rs774951709 chr1:224257069    T/C

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	VASH2	chr1:213160689(+) A-I      intronic chr1:213160848(+) A-I      intronic chr1:213159011(+) A-I      intronic chr1:213140309(+) A-I      intronic chr1:213140349(+) A-I      intronic chr1:213144073(+) A-I      intronic chr1:213160764(+) A-I      intronic chr1:213140363(+) A-I      intronic chr1:213160747(+) A-I      intronic chr1:213144009(+) A-I      intronic chr1:213144164(+) A-I      intronic chr1:213142615(+) A-I      intronic chr1:213160924(+) A-I      intronic chr1:213158387(+) A-I      intronic chr1:213160805(+) A-I      intronic chr1:213160681(+) A-I      intronic chr1:213135134(+) A-I      intronic chr1:213160787(+) A-I      intronic chr1:213158443(+) A-I      intronic chr1:213144125(+) A-I      intronic chr1:213158660(+) A-I      intronic chr1:213143960(+) A-I      intronic chr1:213158904(+) A-I      intronic chr1:213144005(+) A-I      intronic chr1:213158383(+) A-I      intronic chr1:213158450(+) A-I      intronic chr1:213158481(+) A-I      intronic chr1:213158885(+) A-I      intronic chr1:213134972(+) A-I      intronic chr1:213138655(+) A-I      intronic chr1:213140307(+) A-I      intronic chr1:213160773(+) A-I      intronic chr1:213138282(+) A-I      intronic chr1:213138642(+) A-I      intronic chr1:213127782(+) A-I      intronic chr1:213140187(+) A-I      intronic chr1:213144012(+) A-I      intronic chr1:213144111(+) A-I      intronic chr1:213140170(+) A-I      intronic chr1:213140266(+) A-I      intronic chr1:213160906(+) A-I      intronic chr1:213158898(+) A-I      intronic chr1:213160809(+) A-I      intronic chr1:213160753(+) A-I      intronic chr1:213144007(+) A-I      intronic chr1:213158979(+) A-I      intronic chr1:213138659(+) A-I      intronic chr1:213140322(+) A-I      intronic chr1:213140321(+) A-I      intronic chr1:213158503(+) A-I      intronic chr1:213140199(+) A-I      intronic chr1:213160656(+) A-I      intronic chr1:213144112(+) A-I      intronic chr1:213138356(+) A-I      intronic chr1:213158888(+) A-I      intronic chr1:213140211(+) A-I      intronic chr1:213140139(+) A-I      intronic chr1:213138363(+) A-I      intronic chr1:213140257(+) A-I      intronic chr1:213140209(+) A-I      intronic chr1:213132208(+) A-I      intronic chr1:213140339(+) A-I      intronic chr1:213158994(+) A-I      intronic chr1:213160662(+) A-I      intronic chr1:213160785(+) A-I      intronic chr1:213144072(+) A-I      intronic chr1:213160796(+) A-I      intronic chr1:213144017(+) A-I      intronic chr1:213143976(+) A-I      intronic chr1:213158884(+) A-I      intronic chr1:213158785(+) A-I      intronic chr1:213138614(+) A-I      intronic

Resource	Symbol	Editing Position	Change	SeqReg	exReg	PMID
DARNED	VASH2	chr1:213144112(+) A-I intron -    22327324 chr1:213127969(+) T-C intron -    22484847 chr1:213138282(+) A-G intron -    22484847 chr1:213138356(+) A-G intron -    22484847 chr1:213138363(+) A-G intron -    22484847 chr1:213138613(+) T-C intron -    22484847 chr1:213138614(+) A-G intron -    22484847 chr1:213138642(+) A-G intron -    22484847 chr1:213140139(+) A-G intron -    22484847 chr1:213140170(+) A-G intron -    22484847 chr1:213140187(+) A-G intron -    22484847 chr1:213140209(+) A-G intron -    22484847 chr1:213140211(+) A-G intron -    22484847 chr1:213140321(+) A-G intron -    22484847 chr1:213140322(+) A-G intron -    22484847 chr1:213140339(+) A-G intron -    22484847 chr1:213144007(+) A-G intron -    22484847 chr1:213144012(+) A-G intron -    22484847 chr1:213144017(+) A-G intron -    22484847 chr1:213144072(+) A-G intron -    22484847 chr1:213144111(+) A-G intron -    22484847 chr1:213144112(+) A-G intron -    22484847 chr1:213149910(+) T-A intron -    22484847 chr1:213158785(+) A-G intron -    22484847 chr1:213158898(+) A-G intron -    22484847 chr1:213158979(+) A-G intron -    22484847 chr1:213158994(+) A-G intron -    22484847 chr1:213160662(+) A-G intron -    22484847 chr1:213160773(+) A-G intron -    22484847 chr1:213160796(+) A-G intron -    22484847 chr1:213160809(+) A-G intron -    22484847

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	VASH2	chr1:213123889-213123890(+) m6A 5'UTR       25456834 chr1:213123948-213123949(+) m6A 5'UTR       24284625//24209618//25456834//24981863 chr1:213125008-213125009(+) m6A 5'UTR//CDS//exon//intron       - chr1:213125799-213125800(+) m6A exon//intron       24981863 chr1:213125812-213125813(+) m6A exon//intron       24981863 chr1:213125823-213125824(+) m6A exon//intron       24981863 chr1:213125883-213125884(+) m6A exon//intron       25456834//24981863 chr1:213125995-213125996(+) m6A exon//intron       25456834//24981863 chr1:213126009-213126010(+) m6A exon//intron       25456834//24981863 chr1:213126067-213126068(+) m6A exon//intron       25456834//24981863 chr1:213126123-213126124(+) m6A exon//intron       24981863 chr1:213126130-213126131(+) m6A exon//intron       24981863 chr1:213134529-213134530(+) m6A 5'UTR//CDS//exon       24981863 chr1:213140422-213140423(+) m6A exon//intron       24284625 chr1:213145973-213145974(+) m6A CDS//exon       24284625//25456834//24981863//22608085 chr1:213145989-213145990(+) m6A CDS//exon       24284625//25456834//24981863//22608085 chr1:213146073-213146074(+) m6A CDS//exon       24284625//24209618//25456834//24981863//22575960//22608085 chr1:213146093-213146094(+) m6A CDS//exon       24284625//24209618//25456834//24981863//22575960//22608085 chr1:213146124-213146125(+) m6A CDS//exon       24284625//25456834//24981863//22575960//22608085 chr1:213146289-213146290(+) m6A CDS//exon       - chr1:213146833-213146834(+) m6A exon//intron       - chr1:213146886-213146887(+) m6A exon//intron       25456834 chr1:213146928-213146929(+) m6A exon//intron       25456834 chr1:213146959-213146960(+) m6A exon//intron       25456834 chr1:213146982-213146983(+) m6A exon//intron       25456834 chr1:213146995-213146996(+) m6A exon//intron       25456834 chr1:213147015-213147016(+) m6A exon//intron       25456834 chr1:213161999-213162000(+) m6A 3'UTR       24284625//24981863//22608085 chr1:213162019-213162020(+) m6A 3'UTR       24284625//24981863//22608085 chr1:213162146-213162147(+) m6A 3'UTR       24981863//22608085 chr1:213164220-213164221(+) m6A 3'UTR//intron       24981863 chr1:213164251-213164252(+) m6A 3'UTR//intron       24981863 chr1:213164258-213164259(+) m6A 3'UTR//intron       24981863 chr1:213164263-213164264(+) m6A 3'UTR//intron       24981863 chr1:213164268-213164269(+) m6A 3'UTR//intron       24981863

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-320b	Cytoplasm Nasopharyngeal carcinoma cells     20498841 Cytoplasm Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059 Exosome Pooled sera     27278097 Exosome Breast cancer cell line (MCF-7)     20976003 Exosome Ovarian follicular fluid     22116803 Exosome Plasma     23663360 Exosome Colon cancer cell line (LIM1863)     25330373 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Plasma     23077538 Microvesicle Seminal plasma     23539611 Microvesicle Hepatoma cells     23771658 Microvesicle Serum     24797360 Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     - Mitochondrion Skeletal muscle myoblasts     21637849 Mitochondrion Cell line (HEK-293|HeLa)     22984580 Nucleus Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059 Nucleus Nasopharyngeal carcinoma cells     20498841
	VASH2	Exosome Blood     - Nucleoplasm K562 cells     - Nucleus HCC cell line (HepG2)|HeLa-S3 cells     -

Related Drug Information:

Resource	Symbol	Drug Name	PubChem ID	Function	Link
RNAInter	hsa-miR-320b	Eloxatine 5310940 Drug interaction    RC00007663 cis-Diaminedichloroplatinum 2767 Drug interaction    RC00007662 Benzene 241 Drug interaction    RC00007661 Marine fungal metabolite 1386A - Drug interaction    RC00007664

Resource	Symbol	Drug Name	PubChem ID
RNAactDrug	hsa-miR-320b	Topotecan       60700

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-320b
Interactor2: VASH2

Evidence Support:

Weak-Evidence	PAR-CLIP
Support Database	ViRBase

References:

PMID	22291592	Target region	3'UTR
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells	Interactor2 expression	None
Description	We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.