Detail Information

Basic Information:


  VIRBase ID:  

HHID00068736

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-320b:           HLA-DPA1:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-320b HLA-DPA1
miRBase
Accession/Entrez ID
MIMAT0005792 3113
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - DP(W3)//DP(W4)//DPA1//HLA-DP1A//HLA-DPA//HLA-DPB1//HLADP//HLASB//PLT1

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-320b
rs1156276707 chr1:116671796    G/T
rs1311857670 chr1:116671805    GCAAA/G
rs1373244526 chr1:116671806    C/T
rs1434535374 chr1:116671803    G/C
rs755613466 chr1:116671797    T/C
rs779451916 chr1:116671801    G/C
rs1303311077 chr1:224257059    A/T
rs1313950455 chr1:224257062    C/A
rs1333032274 chr1:224257051    G/T
rs1445839645 chr1:224257055    T/C
rs1465806287 chr1:224257050    TGCCC/T
rs745315768 chr1:224257052    C/T
rs769446888 chr1:224257054    C/T
rs1189118293 chr1:116671788    A/G
rs1199375375 chr1:116671794    G/A
rs1411861918 chr1:116671791    G/T
rs1469116635 chr1:116671792    C/CTGGGTTGAGAGGGCAAACAAATTAACTAAT
rs1030808536 chr1:224257064    A/T
rs774951709 chr1:224257069    T/C

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase HLA-DPA1
chr6:33032815-33032816(-) m6A 3'UTR//exon       28052920
chr6:33032850-33032851(-) m6A 3'UTR//exon       28052920
chr6:33037470-33037471(-) m6A CDS//exon       -
chr6:33037549-33037550(-) m6A CDS//exon       -
chr6:33037560-33037561(-) m6A CDS//exon       -
chr6:33037619-33037620(-) m6A CDS//exon       -
chr6:33037659-33037660(-) m6A CDS//exon       -
chr6:33041333-33041334(-) m6A CDS//exon//intron       24981863//28052920
chr6:33041356-33041357(-) m6A 5'UTR//exon//intron       24981863//28052920

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-320b
Cytoplasm Nasopharyngeal carcinoma cells     20498841
Cytoplasm Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059
Exosome Pooled sera     27278097
Exosome Breast cancer cell line (MCF-7)     20976003
Exosome Ovarian follicular fluid     22116803
Exosome Plasma     23663360
Exosome Colon cancer cell line (LIM1863)     25330373
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Plasma     23077538
Microvesicle Seminal plasma     23539611
Microvesicle Hepatoma cells     23771658
Microvesicle Serum     24797360
Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     -
Mitochondrion Skeletal muscle myoblasts     21637849
Mitochondrion Cell line (HEK-293|HeLa)     22984580
Nucleus Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059
Nucleus Nasopharyngeal carcinoma cells     20498841
HLA-DPA1
Cytosol HeLa-S3 cells     -
Exosome Blood     -
Ribosome HEK-293 cells     22199352

Related Drug Information:


Resource Symbol Drug Name PubChem
ID
Function Link  
RNAInter hsa-miR-320b
Eloxatine 5310940 Drug interaction    RC00007663
cis-Diaminedichloroplatinum 2767 Drug interaction    RC00007662
Benzene 241 Drug interaction    RC00007661
Marine fungal metabolite 1386A - Drug interaction    RC00007664
Resource Symbol Drug Name PubChem ID
RNAactDrug hsa-miR-320b
Topotecan       60700

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-320b
Interactor2: HLA-DPA1

Evidence Support:


Weak-Evidence PAR-CLIP
Support Database ViRBase

References:


PMID 22291592 Target region 3'UTR
Source ViRBase Interactor1 expression None
Tissue or cell line EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells Interactor2 expression None
Description We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.

Starting a new search, please wait ...