Detail Information

Basic Information:


  VIRBase ID:  

HHID00068729

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-320b:           COX11:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-320b COX11
miRBase
Accession/Entrez ID		 MIMAT0005792 1353
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - COX11P

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-320b
rs1156276707 chr1:116671796    G/T
rs1311857670 chr1:116671805    GCAAA/G
rs1373244526 chr1:116671806    C/T
rs1434535374 chr1:116671803    G/C
rs755613466 chr1:116671797    T/C
rs779451916 chr1:116671801    G/C
rs1303311077 chr1:224257059    A/T
rs1313950455 chr1:224257062    C/A
rs1333032274 chr1:224257051    G/T
rs1445839645 chr1:224257055    T/C
rs1465806287 chr1:224257050    TGCCC/T
rs745315768 chr1:224257052    C/T
rs769446888 chr1:224257054    C/T
rs1189118293 chr1:116671788    A/G
rs1199375375 chr1:116671794    G/A
rs1411861918 chr1:116671791    G/T
rs1469116635 chr1:116671792    C/CTGGGTTGAGAGGGCAAACAAATTAACTAAT
rs1030808536 chr1:224257064    A/T
rs774951709 chr1:224257069    T/C

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR COX11
chr17:53033901(-) A-I      intronic
chr17:53033862(-) A-I      intronic
chr17:53033831(-) A-I      intronic
chr17:53033815(-) A-I      intronic
chr17:53033571(-) A-I      intronic
chr17:53033790(-) A-I      intronic
chr17:53029799(-) A-I      intronic
chr17:53029839(-) A-I      intronic
chr17:53033772(-) A-I      intronic
chr17:53033582(-) A-I      intronic
chr17:53033882(-) A-I      intronic
chr17:53033594(-) A-I      intronic
chr17:53033873(-) A-I      intronic
chr17:53029784(-) A-I      intronic
chr17:53037582(-) A-I      intronic
chr17:53037184(-) A-I      intronic
chr17:53033920(-) A-I      intronic
chr17:53033926(-) A-I      intronic
chr17:53033839(-) A-I      intronic
chr17:53033827(-) A-I      intronic
chr17:53033621(-) A-I      intronic
chr17:53033611(-) A-I      intronic
chr17:53033951(-) A-I      intronic
chr17:53034062(-) A-I      intronic
chr17:53034063(-) A-I      intronic
chr17:53034078(-) A-I      intronic
chr17:53034079(-) A-I      intronic
chr17:53037242(-) A-I      intronic
chr17:53037578(-) A-I      intronic
chr17:53037562(-) A-I      intronic
chr17:53037196(-) A-I      intronic
chr17:53037245(-) A-I      intronic
chr17:53037507(-) A-I      intronic
chr17:53037267(-) A-I      intronic
chr17:53037259(-) A-I      intronic
chr17:53037251(-) A-I      intronic
chr17:53033644(-) A-I      intronic
chr17:53033657(-) A-I      intronic
chr17:53037111(-) A-I      intronic
chr17:53037145(-) A-I      intronic
chr17:53037146(-) A-I      intronic
chr17:53033579(-) A-I      intronic
chr17:53033589(-) A-I      intronic
chr17:53033590(-) A-I      intronic
chr17:53033719(-) A-I      intronic
chr17:53033738(-) A-I      intronic
chr17:53037147(-) A-I      intronic
chr17:53037157(-) A-I      intronic
chr17:53037205(-) A-I      intronic
chr17:53033634(-) A-I      intronic
chr17:53037614(-) A-I      intronic
chr17:53037604(-) A-I      intronic
chr17:53033794(-) A-I      intronic
chr17:53033893(-) A-I      intronic
chr17:53033937(-) A-I      intronic
chr17:53033942(-) A-I      intronic
chr17:53033949(-) A-I      intronic
chr17:53033984(-) A-I      intronic
chr17:53034005(-) A-I      intronic
chr17:53034033(-) A-I      intronic
chr17:53034056(-) A-I      intronic
chr17:53034087(-) A-I      intronic
chr17:53036730(-) A-I      intronic
chr17:53036739(-) A-I      intronic
chr17:53036770(-) A-I      intronic
chr17:53037008(-) A-I      intronic
chr17:53037026(-) A-I      intronic
chr17:53037044(-) A-I      intronic
chr17:53029845(-) A-I      intronic
chr17:53037055(-) A-I      intronic
chr17:53037567(-) A-I      intronic
chr17:53029672(-) A-I      intronic
chr17:53029725(-) A-I      intronic
chr17:53029742(-) A-I      intronic
chr17:53029751(-) A-I      intronic
chr17:53029825(-) A-I      intronic
chr17:53030483(-) A-I      intronic
chr17:53030495(-) A-I      intronic
chr17:53033578(-) A-I      intronic
chr17:53037099(-) A-I      intronic
chr17:53030522(-) A-I      intronic
chr17:53030549(-) A-I      intronic
chr17:53030601(-) A-I      intronic
chr17:53030654(-) A-I      intronic
chr17:53030708(-) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED COX11
chr17:53029658(-) A-I intron -    15342557
chr17:53029670(-) A-I intron -    15342557
chr17:53029671(-) A-I intron -    15342557
chr17:53029728(-) A-I intron -    15342557
chr17:53029768(-) A-I intron -    15342557
chr17:53029776(-) A-I intron -    15342557
chr17:53029786(-) A-I intron -    15342557
chr17:53029851(-) A-I intron -    15342557
chr17:53029876(-) A-I intron -    15342557
chr17:53030477(-) A-I intron -    15342557
chr17:53030567(-) A-I intron -    15342557
chr17:53030568(-) A-I intron -    15342557
chr17:53030621(-) A-I intron -    15342557
chr17:53030644(-) A-I intron -    15342557
chr17:53030647(-) A-I intron -    15342557
chr17:53030680(-) A-I intron -    15342557
chr17:53033847(-) A-I intron -    15258596
chr17:53033848(-) A-I intron -    15258596
chr17:53033851(-) A-I intron -    15258596
chr17:53033864(-) A-I intron -    15258596
chr17:53033865(-) A-I intron -    15258596
chr17:53033965(-) A-I intron -    15258596

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase COX11
chr17:53030805-53030806(-) m6A exon//intron       25456834
chr17:53030834-53030835(-) m6A exon//intron       25456834
chr17:53030848-53030849(-) m6A exon//intron       25456834
chr17:53030855-53030856(-) m6A exon//intron       25456834
chr17:53030887-53030888(-) m6A exon//intron       25456834
chr17:53030964-53030965(-) m6A exon//intron       -
chr17:53030993-53030994(-) m6A exon//intron       -
chr17:53031183-53031184(-) m6A exon//intron       27773535
chr17:53031254-53031255(-) m6A exon//intron       27773535
chr17:53031984-53031985(-) m6A exon//intron       27773535
chr17:53031990-53031991(-) m6A exon//intron       27773535
chr17:53032056-53032057(-) m6A exon//intron       27773535//22608085
chr17:53032125-53032126(-) m6A exon//intron       27773535//22608085
chr17:53032173-53032174(-) m6A exon//intron       27773535//22608085
chr17:53032229-53032230(-) m6A exon//intron       27773535//22608085
chr17:53032245-53032246(-) m6A exon//intron       27773535//22608085
chr17:53032369-53032370(-) m6A exon//intron       27773535//22608085
chr17:53032419-53032420(-) m6A exon//intron       27773535
chr17:53032436-53032437(-) m6A exon//intron       27773535
chr17:53032449-53032450(-) m6A exon//intron       27773535
chr17:53034944-53034945(-) m6A intron       -
chr17:53034968-53034969(-) m6A intron       -
chr17:53034974-53034975(-) m6A intron       -
chr17:53034986-53034987(-) m6A intron       -
chr17:53038751-53038752(-) m6A 3'UTR//intron       24284625//27773535//22608085
chr17:53038803-53038804(-) m6A 3'UTR//intron       24981863//22608085
chr17:53038852-53038853(-) m6A 3'UTR//intron       22608085
chr17:53038886-53038887(-) m6A 3'UTR//intron       -
chr17:53039083-53039084(-) m6A 3'UTR//intron       27773535
chr17:53039914-53039915(-) m6A 3'UTR//intron       -
chr17:53045732-53045733(-) m6A CDS       24284625//27371828//27773536//22608085
chr17:53045768-53045769(-) Y CDS       26075521
chr17:53045774-53045775(-) m6A CDS       24284625//25456834//27773535//27371828//27773536//22608085
chr17:53045844-53045845(-) m6A CDS       24284625//25456834//24981863//27773535//27371828//27773536//22575960//22608085
chr17:53045860-53045861(-) m6A CDS       24284625//25456834//24981863//27773535//27371828//27773536//22575960//22608085
chr17:53045880-53045881(-) m6A CDS       24284625//25456834//24981863//27773535//27371828//27773536//22575960//22608085

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-320b
Cytoplasm Nasopharyngeal carcinoma cells     20498841
Cytoplasm Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059
Exosome Pooled sera     27278097
Exosome Breast cancer cell line (MCF-7)     20976003
Exosome Ovarian follicular fluid     22116803
Exosome Plasma     23663360
Exosome Colon cancer cell line (LIM1863)     25330373
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Plasma     23077538
Microvesicle Seminal plasma     23539611
Microvesicle Hepatoma cells     23771658
Microvesicle Serum     24797360
Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     -
Mitochondrion Skeletal muscle myoblasts     21637849
Mitochondrion Cell line (HEK-293|HeLa)     22984580
Nucleus Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059
Nucleus Nasopharyngeal carcinoma cells     20498841
COX11
Cytosol Human myelogenous leukemia cell line (K-562)     21613539
Exosome Blood     -
Ribosome Colon cancer cells     24393600

Related Drug Information:


Resource Symbol Drug Name PubChem
ID		 Function Link  
RNAInter hsa-miR-320b
Eloxatine 5310940 Drug interaction    RC00007663
cis-Diaminedichloroplatinum 2767 Drug interaction    RC00007662
Benzene 241 Drug interaction    RC00007661
Marine fungal metabolite 1386A - Drug interaction    RC00007664
Resource Symbol Drug Name PubChem ID
RNAactDrug hsa-miR-320b
Topotecan       60700

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-320b
Interactor2: COX11

Evidence Support:


Weak-Evidence PAR-CLIP
Support Database ViRBase

References:


PMID 22291592 Target region CDS
Source ViRBase Interactor1 expression None
Tissue or cell line EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells Interactor2 expression None
Description We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.

Starting a new search, please wait ...