Detail Information

Basic Information:


  VIRBase ID:  

HHID00059865

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-503-5p:           SRSF11:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-503-5p SRSF11
miRBase
Accession/Entrez ID
MIMAT0002874 9295
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - dJ677H15.2//NET2//p54//SFRS11

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-503-5p
rs1196557079 chrX:134546376    G/A
rs1270166686 chrX:134546378    A/G
rs1295581047 chrX:134546359    ACCGATCGCTCACTGCAGAACTGTTC/A
rs750066682 chrX:134546372    T/C
rs755635214 chrX:134546379    C/G
rs758180396 chrX:134546393    A/AGGGCACGGCTGAGCGC
rs370548043 chrX:134546388    C/T
rs765905801 chrX:134546386    C/A

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR SRSF11
chr1:70707690(+) A-I      intronic
chr1:70676138(+) A-I      intronic
chr1:70683777(+) A-I      intronic
chr1:70676219(+) A-I      intronic
chr1:70676340(+) A-I      intronic
chr1:70675902(+) A-I      intronic
chr1:70673719(+) A-I      intronic
chr1:70707745(+) A-I      intronic
chr1:70707755(+) A-I      intronic
chr1:70707864(+) A-I      intronic
chr1:70676234(+) A-I      intronic
chr1:70676207(+) A-I      intronic
chr1:70708118(+) A-I      intronic
chr1:70708196(+) A-I      intronic
chr1:70675915(+) A-I      intronic
chr1:70686346(+) A-I      intronic
chr1:70682270(+) A-I      intronic
chr1:70682256(+) A-I      intronic
chr1:70676171(+) A-I      intronic
chr1:70676167(+) A-I      intronic
chr1:70675907(+) A-I      intronic
chr1:70676001(+) A-I      intronic
chr1:70686347(+) A-I      intronic
chr1:70686355(+) A-I      intronic
chr1:70682209(+) A-I      intronic
chr1:70676092(+) A-I      intronic
chr1:70678669(+) A-I      intronic
chr1:70706533(+) A-I      intronic
chr1:70706638(+) A-I      intronic
chr1:70676375(+) A-I      intronic
chr1:70707700(+) A-I      intronic
chr1:70673433(+) A-I      intronic
chr1:70707674(+) A-I      intronic
chr1:70708079(+) A-I      intronic
chr1:70707731(+) A-I      intronic
chr1:70708216(+) A-I      intronic
chr1:70704874(+) A-I      intronic
chr1:70707589(+) A-I      intronic
chr1:70676304(+) A-I      intronic
chr1:70706635(+) A-I      intronic
chr1:70683692(+) A-I      intronic
chr1:70680682(+) A-I      intronic
chr1:70707689(+) A-I      intronic
chr1:70676287(+) A-I      intronic
chr1:70676249(+) A-I      intronic
chr1:70676186(+) A-I      intronic
chr1:70676084(+) A-I      intronic
chr1:70672599(+) A-I      intronic
chr1:70678223(+) A-I      intronic
chr1:70676021(+) A-I      intronic
chr1:70707640(+) A-I      intronic
chr1:70676042(+) A-I      intronic
chr1:70676162(+) A-I      intronic
chr1:70678724(+) A-I      intronic
chr1:70678498(+) A-I      intronic
chr1:70676210(+) A-I      intronic
chr1:70682190(+) A-I      intronic
chr1:70691733(+) A-I      intronic
chr1:70709478(+) A-I      intronic
chr1:70707694(+) A-I      intronic
chr1:70676243(+) A-I      intronic
chr1:70682147(+) A-I      intronic
chr1:70678723(+) A-I      intronic
chr1:70680681(+) A-I      intronic
chr1:70708091(+) A-I      intronic
chr1:70691722(+) A-I      intronic
chr1:70682140(+) A-I      intronic
chr1:70678489(+) A-I      intronic
chr1:70681643(+) A-I      intronic
chr1:70707732(+) A-I      intronic
chr1:70682164(+) A-I      intronic
chr1:70676212(+) A-I      intronic
chr1:70678663(+) A-I      intronic
chr1:70680715(+) A-I      intronic
chr1:70675927(+) A-I      intronic
chr1:70676245(+) A-I      intronic
chr1:70678214(+) A-I      intronic
chr1:70707793(+) A-I      intronic
chr1:70676244(+) A-I      intronic
chr1:70675863(+) A-I      intronic
chr1:70706515(+) A-I      intronic
chr1:70707597(+) A-I      intronic
chr1:70676181(+) A-I      intronic
chr1:70706629(+) A-I      intronic
chr1:70678020(+) A-I      intronic
chr1:70674073(+) A-I      intronic
chr1:70676271(+) A-I      intronic
chr1:70678040(+) A-I      intronic
chr1:70706738(+) A-I      intronic
chr1:70678614(+) A-I      intronic
chr1:70675343(+) A-I      intronic
chr1:70678476(+) A-I      intronic
chr1:70708128(+) A-I      intronic
chr1:70707635(+) A-I      intronic
chr1:70708187(+) A-I      intronic
chr1:70678497(+) A-I      intronic
chr1:70676006(+) A-I      intronic
chr1:70709476(+) A-I      intronic
chr1:70676291(+) A-I      intronic
chr1:70680858(+) A-I      intronic
chr1:70676005(+) A-I      intronic
chr1:70707668(+) A-I      intronic
chr1:70708176(+) A-I      intronic
chr1:70676193(+) A-I      intronic
chr1:70678552(+) A-I      intronic
chr1:70680761(+) A-I      intronic
chr1:70675865(+) A-I      intronic
chr1:70675928(+) A-I      intronic
chr1:70707664(+) A-I      intronic
chr1:70680795(+) A-I      intronic
chr1:70676246(+) A-I      intronic
chr1:70706536(+) A-I      intronic
chr1:70673509(+) A-I      intronic
chr1:70709530(+) A-I      intronic
chr1:70708120(+) A-I      intronic
chr1:70678548(+) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED SRSF11
chr1:70676042(+) A-I intron -    22327324
chr1:70673433(+) A-G intron -    22484847
chr1:70675927(+) A-G intron -    22484847
chr1:70675928(+) A-G intron -    22484847
chr1:70676005(+) A-G intron -    22484847
chr1:70676021(+) A-G intron -    22484847
chr1:70676042(+) A-G intron -    22484847
chr1:70676084(+) A-G intron -    22484847
chr1:70676181(+) A-G intron -    22484847
chr1:70676193(+) A-G intron -    22484847
chr1:70676210(+) A-G intron -    22484847
chr1:70676212(+) A-G intron -    22484847
chr1:70676243(+) A-G intron -    22484847
chr1:70676245(+) A-G intron -    22484847
chr1:70676246(+) A-G intron -    22484847
chr1:70676271(+) A-G intron -    22484847
chr1:70676287(+) A-G intron -    22484847
chr1:70678040(+) A-G intron -    22484847
chr1:70678663(+) A-G intron -    22484847
chr1:70678724(+) A-G intron -    22484847
chr1:70680715(+) A-G intron -    22484847
chr1:70680795(+) A-G intron -    22484847
chr1:70680858(+) A-G intron -    22484847
chr1:70682147(+) A-G intron -    22484847
chr1:70682190(+) A-G intron -    22484847
chr1:70691648(+) T-C intron -    22484847
chr1:70691733(+) A-G intron -    22484847
chr1:70691788(+) C-T intron -    22484847
chr1:70706515(+) A-G intron -    22484847
chr1:70706536(+) A-G intron -    22484847
chr1:70706629(+) A-G intron -    22484847
chr1:70707635(+) A-G intron -    22484847
chr1:70707640(+) A-G intron -    22484847
chr1:70707668(+) A-G intron -    22484847
chr1:70707732(+) A-G intron -    22484847
chr1:70708079(+) A-G intron -    22484847
chr1:70708176(+) A-G intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase SRSF11
chr1:70671404-70671405(+) m6A 5'UTR//exon       24981863//22608085
chr1:70687217-70687218(+) m6A 5'UTR//exon//intron       24284625//24209618//24981863
chr1:70687305-70687306(+) m6A 5'UTR//exon       24284625//24209618//24981863//22575960
chr1:70687469-70687470(+) m6A CDS//exon       24981863
chr1:70687501-70687502(+) m6A CDS//exon       24981863
chr1:70703190-70703191(+) Gm CDS//exon       -
chr1:70703230-70703231(+) m6A CDS//exon       24981863//27773535
chr1:70705180-70705181(+) m6A CDS//exon       24981863//27773535
chr1:70705197-70705198(+) m6A CDS//exon       24981863//27773535//22575960
chr1:70710471-70710472(+) Am CDS//exon       -
chr1:70710493-70710494(+) m6A CDS//exon       24981863//27773535//27371828
chr1:70712502-70712503(+) m6A CDS//exon       24981863//27773535//27371828//22608085
chr1:70712517-70712518(+) m6A CDS//exon       24981863//27773535//22608085
chr1:70712540-70712541(+) m6A CDS//exon       24981863//27773535//22608085
chr1:70715607-70715608(+) m6A exon//intron       24981863//27773535//22608085
chr1:70715652-70715653(+) m1A CDS//exon       26863196
chr1:70715790-70715791(+) m6A exon//intron       24981863//27773535//22608085
chr1:70715870-70715871(+) m6A exon//intron       27773535//22608085
chr1:70716006-70716007(+) m6A exon//intron       24981863//22608085
chr1:70716015-70716016(+) m6A exon//intron       24981863//22608085
chr1:70716047-70716048(+) m6A CDS//exon       24284625//24209618//24981863//27773535//22575960//22608085
chr1:70716063-70716064(+) m1A CDS//exon       26863196
chr1:70716076-70716077(+) m6A CDS//exon       24284625//24209618//24981863//28052920//27773535//22575960//22608085
chr1:70716123-70716124(+) m1A CDS//exon       26863196
chr1:70716148-70716149(+) m6A CDS//exon       24284625//24209618//24981863//28052920//27773535//22575960//22608085
chr1:70716319-70716320(+) m6A CDS//exon       24284625//24209618//24981863//28052920//27773535//22575960//22608085
chr1:70716361-70716362(+) m6A CDS//exon       24284625//24209618//25456834//24981863//28052920//27773535//22575960//22608085
chr1:70716371-70716372(+) m6A CDS//exon       24284625//24209618//25456834//24981863//27773535//22575960//22608085
chr1:70716386-70716387(+) m6A CDS//exon       24284625//24209618//25456834//24981863//27773535//22575960//22608085
chr1:70716413-70716414(+) m6A CDS//exon       24284625//24209618//25456834//24981863//27773535//22575960//22608085
chr1:70716468-70716469(+) m6A CDS//exon       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085
chr1:70716575-70716576(+) m6A 3'UTR//exon       24284625//24209618//25456834//24981863//27773535//22608085
chr1:70717473-70717474(+) m6A 3'UTR//exon       27773535
chr1:70717597-70717598(+) m6A 3'UTR//exon       27773535
chr1:70717657-70717658(+) m6A 3'UTR//exon       27773535
chr1:70717671-70717672(+) m6A 3'UTR//exon       27773535
chr1:70717679-70717680(+) m6A 3'UTR//exon       27773535
chr1:70717702-70717703(+) m6A 3'UTR       27773535
chr1:70718587-70718588(+) m6A 3'UTR       27773535
chr1:70718620-70718621(+) m6A 3'UTR       27773535
chr1:70718656-70718657(+) m6A 3'UTR       27773535

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-503-5p
Cytoplasm Breast adenocarcinoma cells (MCF-7)|Cervical adenocarcinoma cells (HeLa)     24918059
Exosome Human umbilical vein endothelial cells     25860935
Exosome Serum     18589210
Exosome Primary dendritic cells|T cell line (J77)     21505438
Exosome Brain tissue     23382797
Exosome Plasma     23663360
Exosome Human mast cell line (HMC-1)     24009880
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Follicular fluid     23666971
Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells     -
Mitochondrion Myotube     27396686
Mitochondrion Skeletal muscle cells     27563705
Mitochondrion Skeletal muscle myoblasts     21637849
Mitochondrion Cell line (HEK-293|HeLa)     22984580
SRSF11
Chromatin K562 cells     -
Cytosol Human myelogenous leukemia cell line (K-562)     21613539
Cytosol HCC cell line (HepG2)|K562 cells     -
Exosome Blood     -
Membrane HCC cell line (HepG2)     -
Nucleolus K562 cells     -
Nucleoplasm K562 cells     -
Nucleus Colon cancer cells     24393600
Nucleus HCC cell line (HepG2)|HeLa-S3 cells|K562 cells     -

Related Drug Information:


Resource Symbol Drug Name PubChem
ID
Function
ncDR hsa-miR-503-5p
Tetrangulol 99188 Drug resistant
Piperidine, 2-methyl-6-undecyl- 99090 Drug resistant
Kahalalide F 9898671 Drug resistant
Gardenin B 96539 Drug resistant
Thiocyanic acid, 1H-purin-6-yl ester 96185 Drug resistant
Tiotixene 941651 Drug resistant
Venenatine 73061 Drug sensitive
1,3,5-Triacryloylhexahydro-1,3,5-triazine 70397 Drug resistant
Melicopidine 68060 Drug resistant
Silver mesylate 6712944 Drug resistant
Dihydroartemisinyl ether, stereoisomer of NSC-685989 6712439 Drug resistant
N-(4-Methoxyphenyl)-all-trans-retinamide 6385696 Drug resistant
Acetamide, N-(2-hydroxy-9-oxo-1,3,10-trimethoxy-5,6,7,9-tetrahydrobenzo(a)heptalen-7-yl)-2,2,2-trifluoro- 634898 Drug resistant
Verrucarin A, 3'-(acetyloxy)-7'-deoxo-2'-deoxy-4'-hydroxy-7'-(1-hydroxyethyl)- 5933240 Drug resistant
1,1'-Diethyl-2,2'-cyanine chloride 5717105 Drug resistant
Thapsia villosa compd 5477211 Drug resistant
(Z)-3-Iodo-1,2-diphenyl-2-propen-1-one 5468683 Drug resistant
Ferric-taxol 54612932 Drug resistant
p-Chloranilinum[bis(p-chloraniline)dioxalatoruthenate(III)] 54608061 Drug resistant
Biantrazole 54607781 Drug sensitive
(10R,13R,16R,19S)-16-Butan-2-yl-3-(3-chloro-2-hydroxypropyl)-10,11,14-trimethyl-13-propan-2-yl-4-oxa-1,8,11,14,17-pentazabicyclo[17.3.0]docosane-2,5,9,12,15,18-hexone 5459202 Drug resistant
Betuletol 5459196 Drug sensitive
1-Piperidineethanol, alpha-[p-(p-chlorostyryl)phenyl]- 5351150 Drug resistant
Cyclosporin A 5284373 Drug resistant
Dichloroplatinum; 2-(4-methoxyphenyl)ethanamine 498558 Drug resistant
Staurosporine, 98% 49831000 Drug sensitive
Hopeaphenol 495605 Drug resistant
2-(2-Amino-3-methoxyphenyl)-4H-1-benzopyran-4-one 4713 Drug resistant
(S)-(+)-Tert-Butyl 2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetate 46907787 Drug resistant
CID 44581723 44581723 Drug resistant
Oxyacanthine 442333 Drug resistant
14-Methoxy-epothilone D 44225568 Drug resistant
Calactin 441849 Drug sensitive
Griseofulvin 441140 Drug resistant
Ouabain 439501 Drug sensitive
Digitoxigenin 4369270 Drug sensitive
6-Iodo-3-(phenylamino)-2-(2-thieny)-3H-quinazolin-4-one 404725 Drug resistant
Fagaronine chloride 40304 Drug sensitive
Triacetyl crambescidin 800 hydrochloride 400721 Drug resistant
Cbz-[Lys3]-Didemnin B 398464 Drug resistant
Trapoxin B 395803 Drug resistant
15-Oxozoapatlin 391317 Drug resistant
7,8-Dehydrocalotropin 390666 Drug sensitive
2-Ethylaminoestradiol 384235 Drug resistant
(-)7,8-Dihydrocalanolide A 383107 Drug sensitive
3-Methoxy-4-hydroxybenzaldehyde [1-(phenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-yl]hydrazone 3805075 Drug resistant
2-(2-(Dimethylamino)ethylamino)naphthazarin 376950 Drug resistant
Diethoxybis(1,4-naphthochinone-2-olato)titanium(IV) 368297 Drug resistant
(4-Methoxyphenyl)-(3,4,5-trimethoxyphenyl)methanol 368140 Drug resistant
Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(IV) 368058 Drug resistant
4-N,N-Bis-2'-cyanoethylaminobenzylidene-4-fluoro aniline 359414 Drug resistant
Thiosangivamycin 3580213 Drug resistant
Haloprogin 3561 Drug resistant
Free base of NSC 610966 355990 Drug resistant
2-Benzoylaminobenzamide, N-thiazol-2-yl- 355710 Drug resistant
Ellipticine 3213 Drug sensitive
Clomifene citrate 3033832 Drug resistant
Tamoxifen 2733526 Drug resistant
Digoxin 2724385 Drug sensitive
Chelerythrine 2703 Drug resistant
4'-(1H-Benzimidazol-2-yl)1,1biphenyl-4-amine 24205338 Drug resistant
2[4'Aminobiphenyl]5,6dichlorobenzimidazole 24205088 Drug resistant
(2-Methoxy-9,10-dihydrophenanthren-3-yl)methyl-dimethyl-(phenylsulfanylmethyl)azanium;bromide 24200489 Drug resistant
[(1R,2S,4R,6R,7R,10S,11R,14S,16S)-16-Hydroxy-7,11-dimethyl-6-(6-oxopyran-3-yl)-3-oxapentacyclo[8.8.0.02,4.02,7.011,16]octadecan-14-yl] acetate 23618199 Drug sensitive
2-Chloro-3-phenoxy-1,4-naphthoquinone 219799 Drug resistant
2-Bromo-4-methyl-1,3,5-trinitrobenzene 219376 Drug resistant
Pirarubicin hydrochloride 20846247 Drug sensitive
Chonemorphine 165208 Drug resistant
Thevetin 159331 Drug sensitive
Roseophilin, HCl salt 135499311 Drug resistant
Sendanin 12806435 Drug resistant
Indotecan 11533060 Drug sensitive
2,9-Dimethylellipticinium acetate 10472068 Drug sensitive
9-Chloro-2-methylellipticinium acetate, hydrate 10383530 Drug sensitive
Bialamicol 10304 Drug resistant
Fusariotoxin T-2 102515111 Drug resistant
[(1R,3R,5R,8R,9S,10R,13R,14S,17R)-3-[(2R,3R,4R,5R,6S)-3,5-Dihydroxy-4-methoxy-6-methyloxan-2-yl]oxy-10,14-dihydroxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-1-yl] acetate 101973931 Drug sensitive
1,8-naphthyridin-4(1h)-one, 2-(4-fluorophenyl)-5-methyl- - Drug resistant
1-[5-(4-methoxyphenyl)-4,5-dihydro-1H-pyrazol-3-yl]-5-phenyl-1H-tetrazole - Drug resistant
1-octene, 3-(bromomethyl)-2,3,7-trichloro-7-methyl- - Drug resistant
5,6-dimethyl-9-oxo-9h-xanthene-4-acetic acid, sodium salt - Drug resistant
5-[2-(4-methoxyphenyl)ethyl]-1,2,3-dimethoxy benzene - Drug resistant
anthraquinone, 1-hydroxy-4-[p-(2-hydroxyethyl)anilino]- - Drug resistant
arabinofuranosyl cytosine 5'-oleyl phosphate monosodium, - Drug resistant
benzene, 1-methoxy-4-(2-nitroethenyl)-, (e)- - Drug resistant
benzofuro[3,2-b]benzopyran-11-one, 3-hydroxy- - Drug resistant
inosine, 6-thio-, 2',3',5'-tripentanoate - Drug resistant
iodonium, (4-methoxyphenyl)(3-methylphenyl)-, bromide - Drug resistant
naphtho[2,3-b]furan-4,9-dione, 2-bromo- - Drug resistant
sp-adenosine-3',5'-cyclic phosphorothioate - Drug resistant
thiourea, n-(1-ethylpropyl)-n'-[(2-thienyl)thioxomethyl]- - Drug resistant
antineoplastic-625577 - Drug resistant
antineoplastic-d183258 - Drug resistant
bafilomycin antibiotic - Drug resistant
bafilomycin deriv - Drug resistant
Benzimate - Drug resistant
hyperforinacetate - Drug resistant
nitrin (van) - Drug resistant
xenorhabdin 1 - Drug resistant
(2e,8s,9z)-2,9,16-heptadecatrien-4,6-diyn-1,8-diol - Drug sensitive
(3-(4-bromophenyl)-5-(1,3-diphenyl-1H-pyrazol-4-yl)-4,5-dihydropyrazol-1-yl)(4-methoxyphenyl)methanone - Drug sensitive
2-methylellpticinium - Drug sensitive
Camptothecin Derivative - Drug sensitive
digitoxigenin glycoside - Drug sensitive
organosulfur compound - Drug sensitive
toxin .delta.53l - Drug sensitive
Resource Symbol Drug Name PubChem
ID
Function Link  
RNAInter hsa-miR-503-5p
10-Hydroxycamptothecin 97226 Drug interaction    RC00005725
Curcumin 969516 Drug interaction    RC00005727
Ethanol 702 Drug interaction    RC00005718
Gemcitabine 60750 Drug interaction    RC00005724
Temozolomide 5394 Drug interaction    RC00005721
Etoposide 36462 Drug interaction    RC00005723
5-Fluorouracil 3385 Drug interaction    RC00005720
Doxorubicin 31703 Drug interaction    RC00005722
cis-Diaminedichloroplatinum 2767 Drug interaction    RC00005719
N-(3-(5-Chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluorophenyl)propane-1-sulfonamide 24180719 Drug interaction    RC00005728
Docetaxel 148124 Drug interaction    RC00005726
Resource Symbol Drug Name PubChem ID PMID
NoncoRNA hsa-miR-503-5p
Oxaliplatin 9887053       28423513
N-(3-(5-Chloro-1H-pyrrolo[2,3-b]pyridine-3-carbonyl)-2,4-difluorophenyl)propane-1-sulfonamide 24180719       26456124

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-503-5p
Interactor2: SRSF11

Evidence Support:


Weak-Evidence PAR-CLIP
Support Database ViRBase

References:


PMID 22291592 Target region CDS
Source ViRBase Interactor1 expression None
Tissue or cell line EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells Interactor2 expression None
Description We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.

Starting a new search, please wait ...