Basic Information:

  VIRBase ID:  

HHID00059717

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:  MIMAT0002853          TXLNA:  NM_001376858     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-519d-3p	TXLNA
miRBase Accession/Entrez ID	MIMAT0002853	200081
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	IL14//TXLN

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-519d-3p	rs1031566931 chr19:53713420    T/A rs116796400 chr19:53713416    A/G rs1177367352 chr19:53713409    T/A rs1362826944 chr19:53713419    G/T rs1443130720 chr19:53713413    T/A rs748935087 chr19:53713417    G/T rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA rs754470034 chr19:53713415    T/TACCAA rs754470034 chr19:53713415    T/TA rs754629979 chr19:53713421    G/T rs755601254 chr19:53713414    T/A rs752048127 chr19:53713406    G/T rs764695340 chr19:53713405    T/G

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	TXLNA	chr1:32647998(+) A-I      intronic chr1:32648053(+) A-I      intronic chr1:32648457(+) A-I      intronic chr1:32648436(+) A-I      intronic chr1:32648152(+) A-I      intronic chr1:32648110(+) A-I      intronic chr1:32648987(+) A-I      intronic chr1:32648972(+) A-I      intronic chr1:32648941(+) A-I      intronic chr1:32648866(+) A-I      intronic chr1:32655364(+) A-I      intronic chr1:32654184(+) A-I      intronic chr1:32655341(+) A-I      intronic chr1:32655160(+) A-I      intronic chr1:32653990(+) A-I      intronic chr1:32651484(+) A-I      intronic chr1:32648007(+) A-I      intronic chr1:32653978(+) A-I      intronic chr1:32649524(+) A-I      intronic chr1:32654063(+) A-I      intronic chr1:32648077(+) A-I      intronic chr1:32648511(+) A-I      intronic chr1:32648076(+) A-I      intronic chr1:32648413(+) A-I      intronic chr1:32648440(+) A-I      intronic chr1:32648209(+) A-I      intronic chr1:32649216(+) A-I      intronic chr1:32648006(+) A-I      intronic chr1:32654151(+) A-I      intronic chr1:32648252(+) A-I      intronic chr1:32648547(+) A-I      intronic chr1:32648932(+) A-I      intronic chr1:32648103(+) A-I      intronic chr1:32655310(+) A-I      intronic chr1:32653991(+) A-I      intronic chr1:32648907(+) A-I      intronic chr1:32648223(+) A-I      intronic chr1:32654118(+) A-I      intronic chr1:32649238(+) A-I      intronic chr1:32648910(+) A-I      intronic chr1:32655416(+) A-I      intronic chr1:32654119(+) A-I      intronic chr1:32649467(+) A-I      intronic chr1:32655220(+) A-I      intronic chr1:32655311(+) A-I      intronic chr1:32653984(+) A-I      intronic chr1:32648107(+) A-I      intronic chr1:32654054(+) A-I      intronic chr1:32651561(+) A-I      intronic chr1:32655223(+) A-I      intronic chr1:32654074(+) A-I      intronic chr1:32655226(+) A-I      intronic chr1:32648805(+) A-I      intronic chr1:32648407(+) A-I      intronic chr1:32648548(+) A-I      intronic chr1:32649438(+) A-I      intronic chr1:32651490(+) A-I      intronic chr1:32648517(+) A-I      intronic chr1:32648890(+) A-I      intronic chr1:32654180(+) A-I      intronic chr1:32649479(+) A-I      intronic chr1:32648769(+) A-I      intronic chr1:32648545(+) A-I      intronic chr1:32655215(+) A-I      intronic chr1:32648744(+) A-I      intronic chr1:32648143(+) A-I      intronic chr1:32653985(+) A-I      intronic chr1:32648444(+) A-I      intronic chr1:32654116(+) A-I      intronic chr1:32649450(+) A-I      intronic chr1:32649213(+) A-I      intronic chr1:32648986(+) A-I      intronic

Resource	Symbol	Editing Position	Change	SeqReg	exReg	PMID
DARNED	TXLNA	chr1:32648143(+) A-G intron -    22484847 chr1:32648407(+) A-G intron -    22484847 chr1:32648413(+) A-G intron -    22484847 chr1:32648440(+) A-G intron -    22484847 chr1:32648444(+) A-G intron -    22484847 chr1:32648511(+) A-G intron -    22484847 chr1:32648545(+) A-G intron -    22484847 chr1:32648547(+) A-G intron -    22484847 chr1:32648548(+) A-G intron -    22484847 chr1:32648769(+) A-G intron -    22484847 chr1:32648907(+) A-G intron -    22484847 chr1:32648932(+) A-G intron -    22484847 chr1:32649238(+) A-G intron -    22484847 chr1:32649438(+) A-G intron -    22484847 chr1:32649450(+) A-G intron -    22484847 chr1:32649467(+) A-G intron -    22484847 chr1:32649479(+) A-G intron -    22484847 chr1:32649524(+) A-G intron -    22484847 chr1:32651490(+) A-G intron -    22484847 chr1:32653978(+) A-G intron -    22484847 chr1:32653984(+) A-G intron -    22484847 chr1:32653985(+) A-G intron -    22484847 chr1:32653991(+) A-G intron -    22484847 chr1:32654063(+) A-G intron -    22484847 chr1:32654074(+) A-G intron -    22484847 chr1:32654116(+) A-G intron -    22484847 chr1:32654118(+) A-G intron -    22484847 chr1:32654119(+) A-G intron -    22484847 chr1:32654180(+) A-G intron -    22484847 chr1:32655143(+) T-C intron -    22484847 chr1:32655223(+) A-G intron -    22484847 chr1:32655226(+) A-G intron -    22484847 chr1:32655310(+) A-G intron -    22484847 chr1:32655311(+) A-G intron -    22484847

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	TXLNA	chr1:32645771-32645772(+) m6A 5'UTR//intron       24284625//24209618//24981863 chr1:32645953-32645954(+) m6A CDS       24284625//24209618//25456834//24981863//27371828//27773536//22575960//22608085 chr1:32645959-32645960(+) m6A CDS       24284625//24209618//25456834//24981863//27371828//27773536//22575960//22608085 chr1:32645981-32645982(+) m6A CDS       24284625//24209618//25456834//24981863//27371828//27773536//22575960//22608085 chr1:32646008-32646009(+) m6A CDS       24284625//24209618//25456834//24981863//27371828//27773536//22575960//22608085 chr1:32646023-32646024(+) m6A CDS       24284625//24209618//25456834//24981863//27371828//27773536//22575960//22608085 chr1:32646914-32646915(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr1:32646938-32646939(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085 chr1:32646990-32646991(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085 chr1:32647015-32647016(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085 chr1:32647044-32647045(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085 chr1:32647074-32647075(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr1:32647094-32647095(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960 chr1:32647130-32647131(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960 chr1:32647136-32647137(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960 chr1:32650151-32650152(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960 chr1:32650213-32650214(+) m6A CDS       24284625//24209618//24981863//22575960 chr1:32653630-32653631(+) m6A CDS       24284625//24209618//24981863//22575960 chr1:32655753-32655754(+) m6A CDS       24284625//24209618//24981863 chr1:32655791-32655792(+) m6A CDS       24284625//24209618//24981863 chr1:32657931-32657932(+) m6A CDS       24209618//24981863//27773535//22575960 chr1:32657939-32657940(+) m6A CDS       24209618//24981863//27773535//22575960 chr1:32658314-32658315(+) m6A CDS       24284625//24209618//24981863//27773535//22575960 chr1:32658845-32658846(+) m6A CDS       24284625//24209618//24981863//27773535 chr1:32659698-32659699(+) m6A CDS       24284625//24209618//24981863//27773535//22575960//22608085 chr1:32660505-32660506(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr1:32660522-32660523(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr1:32660580-32660581(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//22575960//22608085 chr1:32660599-32660600(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//22575960//22608085 chr1:32660614-32660615(+) m6A CDS       24284625//24209618//25456834//24981863//26404942//22575960//22608085 chr1:32660760-32660761(+) m6A CDS       24284625//24209618//25456834//24981863//22575960//22608085

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-519d-3p	Exosome Serum     18589210 Exosome Human mast cell line (HMC-1)     24009880 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Fibroblasts     -
	TXLNA	Chromatin K562 cells     - Cytosol HCC cell line (HepG2)|K562 cells     - Exosome Blood     - Nucleolus K562 cells     - Nucleoplasm K562 cells     - Nucleus Colon cancer cells     24393600 Nucleus HCC cell line (HepG2)|HeLa-S3 cells|K562 cells     - Ribosome HEK-293 cells     22199352

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-519d-3p
Interactor2: TXLNA

Evidence Support:

Weak-Evidence	HITS-CLIP
Support Database	ViRBase

References:

PMID	22473208	Target region	3'UTR
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	Jijoye cells	Interactor2 expression	None
Description	Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).