Basic Information:

  VIRBase ID:  

HHID00059712

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:  MIMAT0002853          BMT2:  NM_152556     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-519d-3p	BMT2
miRBase Accession/Entrez ID	MIMAT0002853	154743
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	C7orf60//SAMTOR

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-519d-3p	rs1031566931 chr19:53713420    T/A rs116796400 chr19:53713416    A/G rs1177367352 chr19:53713409    T/A rs1362826944 chr19:53713419    G/T rs1443130720 chr19:53713413    T/A rs748935087 chr19:53713417    G/T rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA rs754470034 chr19:53713415    T/TACCAA rs754470034 chr19:53713415    T/TA rs754629979 chr19:53713421    G/T rs755601254 chr19:53713414    T/A rs752048127 chr19:53713406    G/T rs764695340 chr19:53713405    T/G

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	BMT2	chr7:112497348(-) A-I      intronic chr7:112497341(-) A-I      intronic chr7:112472336(-) A-I      intronic chr7:112502227(-) A-I      intronic chr7:112501440(-) A-I      intronic chr7:112527112(-) A-I      intronic chr7:112546859(-) A-I      intronic chr7:112546809(-) A-I      intronic chr7:112546805(-) A-I      intronic chr7:112546804(-) A-I      intronic chr7:112546791(-) A-I      intronic chr7:112533813(-) A-I      intronic chr7:112527063(-) A-I      intronic chr7:112505930(-) A-I      intronic chr7:112505917(-) A-I      intronic chr7:112505240(-) A-I      intronic chr7:112472361(-) A-I      intronic chr7:112505054(-) A-I      intronic chr7:112505987(-) A-I      intronic chr7:112504931(-) A-I      intronic chr7:112502228(-) A-I      intronic chr7:112533809(-) A-I      intronic chr7:112530995(-) A-I      intronic chr7:112502198(-) A-I      intronic chr7:112502162(-) A-I      intronic chr7:112555039(-) A-I      intronic chr7:112471707(-) A-I      intronic chr7:112472329(-) A-I      intronic chr7:112506007(-) A-I      intronic chr7:112502201(-) A-I      intronic chr7:112531003(-) A-I      intronic chr7:112490196(-) A-I      intronic chr7:112496469(-) A-I      intronic

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-519d-3p	Exosome Serum     18589210 Exosome Human mast cell line (HMC-1)     24009880 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Fibroblasts     -
	BMT2	Chromatin K562 cells     - Cytosol Human myelogenous leukemia cell line (K-562)     21613539 Exosome Blood     - Nucleus HCC cell line (HepG2)|K562 cells     -

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-519d-3p
Interactor2: BMT2

Evidence Support:

Weak-Evidence	HITS-CLIP
Support Database	ViRBase

References:

PMID	22473208	Target region	3'UTR
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	Jijoye cells	Interactor2 expression	None
Description	Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).