Basic Information:

  VIRBase ID:  

HHID00059707

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:  MIMAT0002853          ZNF597:  NM_152457     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-519d-3p	ZNF597
miRBase Accession/Entrez ID	MIMAT0002853	146434
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	HIT-4

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-519d-3p	rs1031566931 chr19:53713420    T/A rs116796400 chr19:53713416    A/G rs1177367352 chr19:53713409    T/A rs1362826944 chr19:53713419    G/T rs1443130720 chr19:53713413    T/A rs748935087 chr19:53713417    G/T rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA rs754470034 chr19:53713415    T/TACCAA rs754470034 chr19:53713415    T/TA rs754629979 chr19:53713421    G/T rs755601254 chr19:53713414    T/A rs752048127 chr19:53713406    G/T rs764695340 chr19:53713405    T/G

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	ZNF597	chr16:3490445(-) A-I      intronic chr16:3488033(-) A-I      intronic chr16:3491941(-) A-I      intronic

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	ZNF597	chr16:3486200-3486201(-) m6A 3'UTR       27773535 chr16:3486213-3486214(-) m6A 3'UTR       27773535 chr16:3486225-3486226(-) m6A 3'UTR       27773535 chr16:3486433-3486434(-) m6A CDS       25456834//24981863//27773535//22608085 chr16:3486446-3486447(-) m6A CDS       25456834//24981863//27773535//22608085 chr16:3486485-3486486(-) m6A CDS       25456834//24981863//27773535//27371828//22608085 chr16:3486513-3486514(-) m6A CDS       25456834//24981863//27773535//27371828//22608085 chr16:3486549-3486550(-) m6A CDS       25456834//24981863//27773535//27371828//22575960//22608085 chr16:3486556-3486557(-) m6A CDS       25456834//24981863//27773535//27371828//22575960//22608085 chr16:3486581-3486582(-) m6A CDS       25456834//24981863//27773535//27371828//22575960//22608085 chr16:3486616-3486617(-) m6A CDS       25456834//24981863//27773535//27371828//22575960//22608085 chr16:3486709-3486710(-) m6A CDS       24981863//27773535//22608085 chr16:3486736-3486737(-) m6A CDS       24981863//27773535//22608085 chr16:3486833-3486834(-) m6A CDS       24981863//27773535//22608085 chr16:3486858-3486859(-) m6A CDS       24981863//27773535//22608085 chr16:3486873-3486874(-) m6A CDS       24981863//27773535//22575960//22608085 chr16:3486901-3486902(-) m6A CDS       24981863//27773535//22575960//22608085 chr16:3487068-3487069(-) m6A CDS       24981863//27773535//22575960//22608085 chr16:3487097-3487098(-) m6A CDS       24981863//27773535//22575960//22608085 chr16:3487149-3487150(-) m6A CDS       24981863//27773535//22608085 chr16:3487207-3487208(-) m6A CDS       24981863//27773535//27371828//22608085 chr16:3487286-3487287(-) m6A CDS       24981863//27773535//22608085 chr16:3487305-3487306(-) m6A CDS       24981863//27773535//22608085 chr16:3487324-3487325(-) m6A CDS       24981863//27773535//22608085 chr16:3487373-3487374(-) m6A CDS       24981863//27773535//22608085 chr16:3487399-3487400(-) m6A CDS       24981863//27773535//22608085 chr16:3487485-3487486(-) m6A CDS       24981863//27773535

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-519d-3p	Exosome Serum     18589210 Exosome Human mast cell line (HMC-1)     24009880 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Fibroblasts     -
	ZNF597	Exosome Blood     -

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-519d-3p
Interactor2: ZNF597

Evidence Support:

Weak-Evidence	HITS-CLIP
Support Database	ViRBase

References:

PMID	22473208	Target region	None
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	Jijoye cells	Interactor2 expression	None
Description	Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).