Detail Information

Basic Information:


  VIRBase ID:  

HHID00059668

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:           PARD6B:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-519d-3p PARD6B
miRBase
Accession/Entrez ID
MIMAT0002853 84612
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - PAR6B

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-519d-3p
rs1031566931 chr19:53713420    T/A
rs116796400 chr19:53713416    A/G
rs1177367352 chr19:53713409    T/A
rs1362826944 chr19:53713419    G/T
rs1443130720 chr19:53713413    T/A
rs748935087 chr19:53713417    G/T
rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA
rs754470034 chr19:53713415    T/TACCAA
rs754470034 chr19:53713415    T/TA
rs754629979 chr19:53713421    G/T
rs755601254 chr19:53713414    T/A
rs752048127 chr19:53713406    G/T
rs764695340 chr19:53713405    T/G

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR PARD6B
chr20:49357637(+) A-I      intronic
chr20:49353437(+) A-I      intronic
chr20:49353395(+) A-I      intronic
chr20:49351511(+) A-I      intronic
chr20:49351320(+) A-I      intronic
chr20:49355823(+) A-I      intronic
chr20:49351024(+) A-I      intronic
chr20:49355822(+) A-I      intronic
chr20:49351022(+) A-I      intronic
chr20:49351425(+) A-I      intronic
chr20:49372363(+) A-I      intronic
chr20:49365181(+) A-I      intronic
chr20:49364638(+) A-I      intronic
chr20:49364614(+) A-I      intronic
chr20:49362305(+) A-I      intronic
chr20:49360305(+) A-I      intronic
chr20:49360170(+) A-I      intronic
chr20:49358717(+) A-I      intronic
chr20:49358660(+) A-I      intronic
chr20:49358641(+) A-I      intronic
chr20:49358629(+) A-I      intronic
chr20:49355864(+) A-I      intronic
chr20:49351454(+) A-I      intronic
chr20:49355837(+) A-I      intronic
chr20:49372439(+) A-I      intronic
chr20:49372444(+) A-I      intronic
chr20:49360315(+) A-I      intronic
chr20:49355831(+) A-I      intronic
chr20:49355819(+) A-I      intronic
chr20:49355807(+) A-I      intronic
chr20:49353418(+) A-I      intronic
chr20:49353364(+) A-I      intronic
chr20:49353312(+) A-I      intronic
chr20:49353299(+) A-I      intronic
chr20:49353291(+) A-I      intronic
chr20:49351632(+) A-I      intronic
chr20:49351608(+) A-I      intronic
chr20:49351607(+) A-I      intronic
chr20:49372434(+) A-I      intronic
chr20:49360214(+) A-I      intronic
chr20:49351293(+) A-I      intronic
chr20:49353496(+) A-I      intronic
chr20:49360217(+) A-I      intronic
chr20:49351556(+) A-I      intronic
chr20:49370830(+) A-I      intronic
chr20:49350945(+) A-I      intronic
chr20:49351567(+) A-I      intronic
chr20:49353487(+) A-I      intronic
chr20:49360237(+) A-I      intronic
chr20:49357772(+) A-I      intronic
chr20:49350937(+) A-I      intronic
chr20:49365176(+) A-I      intronic
chr20:49365786(+) A-I      intronic
chr20:49349951(+) A-I      intronic
chr20:49368157(+) A-I      3'UTR
chr20:49364766(+) A-I      intronic
chr20:49365603(+) A-I      intronic
chr20:49360781(+) A-I      intronic
chr20:49362318(+) A-I      intronic
chr20:49365356(+) A-I      intronic
chr20:49353308(+) A-I      intronic
chr20:49365702(+) A-I      intronic
chr20:49365291(+) A-I      intronic
chr20:49365349(+) A-I      intronic
chr20:49351501(+) A-I      intronic
chr20:49362176(+) A-I      intronic
chr20:49349776(+) A-I      intronic
chr20:49361809(+) A-I      intronic
chr20:49360171(+) A-I      intronic
chr20:49360791(+) A-I      intronic
chr20:49365721(+) A-I      intronic
chr20:49355374(+) A-I      intronic
chr20:49358764(+) A-I      intronic
chr20:49351566(+) A-I      intronic
chr20:49372457(+) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED PARD6B
chr20:49349747(+) A-I intron -    21960545
chr20:49351017(+) A-I intron -    21960545
chr20:49351022(+) A-I intron -    21960545
chr20:49351241(+) A-I intron -    21960545
chr20:49351293(+) A-I intron -    21960545
chr20:49351567(+) A-I intron -    21960545
chr20:49355420(+) A-I intron -    21960545
chr20:49362282(+) A-I intron -    21960545
chr20:49362305(+) A-I intron -    21960545
chr20:49362306(+) A-I intron -    21960545
chr20:49365291(+) A-I intron -    21960545
chr20:49365349(+) A-G intron -    22484847
chr20:49365689(+) G-C intron -    22484847
chr20:49365702(+) A-G intron -    22484847
chr20:49365721(+) A-G intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase PARD6B
chr20:49348327-49348328(+) m6A CDS       -
chr20:49354434-49354435(+) m6A CDS       22608085
chr20:49354517-49354518(+) m6A CDS       24981863//22608085
chr20:49354529-49354530(+) m6A CDS       24981863//22608085
chr20:49366204-49366205(+) m6A CDS//intron       24284625//24981863//22608085
chr20:49366225-49366226(+) m6A CDS//intron       24284625//24981863//22608085
chr20:49366318-49366319(+) m6A CDS//intron       24284625//24981863//22608085
chr20:49366325-49366326(+) m6A CDS//intron       24284625//24981863//22608085
chr20:49366406-49366407(+) m6A CDS//intron       24284625//24981863//27773535//22608085
chr20:49366526-49366527(+) m6A CDS//intron       24284625//24981863//27773535//22575960//22608085
chr20:49366603-49366604(+) m6A CDS//intron       24284625//24981863//27773535//22575960//22608085
chr20:49366646-49366647(+) m6A CDS//intron       24284625//24981863//27773535//22575960//22608085
chr20:49366654-49366655(+) m6A CDS//intron       24284625//24981863//27773535//22575960//22608085
chr20:49366678-49366679(+) m6A CDS//intron       24284625//24981863//27773535//22575960//22608085
chr20:49366686-49366687(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366748-49366749(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366774-49366775(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366804-49366805(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366895-49366896(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366954-49366955(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366968-49366969(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49366988-49366989(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49367007-49367008(+) m6A CDS//intron       24284625//25456834//24981863//27773535//22575960//22608085
chr20:49367026-49367027(+) m6A 3'UTR//intron       24284625//24981863//27773535//22575960//22608085
chr20:49367066-49367067(+) m6A 3'UTR//intron       24284625//24981863//27773535//22575960//22608085
chr20:49367192-49367193(+) m6A 3'UTR//intron       24981863//27773535//22608085
chr20:49367226-49367227(+) m6A 3'UTR//intron       24981863//22608085
chr20:49367307-49367308(+) m6A 3'UTR//intron       22608085
chr20:49367320-49367321(+) m6A 3'UTR//intron       22608085

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-519d-3p
Exosome Serum     18589210
Exosome Human mast cell line (HMC-1)     24009880
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Fibroblasts     -
PARD6B
Chromatin K562 cells     -
Cytoplasm Nasopharyngeal carcinoma cells     20498841
Exosome Blood     -
Nucleoplasm K562 cells     -
Nucleus Nasopharyngeal carcinoma cells     20498841

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-519d-3p
Interactor2: PARD6B

Evidence Support:


Weak-Evidence HITS-CLIP
Support Database ViRBase

References:


PMID 22473208 Target region 3'UTR
Source ViRBase Interactor1 expression None
Tissue or cell line Jijoye cells Interactor2 expression None
Description Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).

Starting a new search, please wait ...