Detail Information

Basic Information:


  VIRBase ID:  

HHID00059667

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:           MAK16:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-519d-3p MAK16
miRBase
Accession/Entrez ID		 MIMAT0002853 84549
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - MAK16L//RBM13

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-519d-3p
rs1031566931 chr19:53713420    T/A
rs116796400 chr19:53713416    A/G
rs1177367352 chr19:53713409    T/A
rs1362826944 chr19:53713419    G/T
rs1443130720 chr19:53713413    T/A
rs748935087 chr19:53713417    G/T
rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA
rs754470034 chr19:53713415    T/TACCAA
rs754470034 chr19:53713415    T/TA
rs754629979 chr19:53713421    G/T
rs755601254 chr19:53713414    T/A
rs752048127 chr19:53713406    G/T
rs764695340 chr19:53713405    T/G

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR MAK16
chr8:33345720(+) A-I      intronic
chr8:33345666(+) A-I      intronic
chr8:33355281(+) A-I      intronic
chr8:33355458(+) A-I      intronic
chr8:33355456(+) A-I      intronic
chr8:33355467(+) A-I      intronic
chr8:33355394(+) A-I      intronic
chr8:33355375(+) A-I      intronic
chr8:33355461(+) A-I      intronic
chr8:33355286(+) A-I      intronic
chr8:33355250(+) A-I      intronic
chr8:33355231(+) A-I      intronic
chr8:33355251(+) A-I      intronic
chr8:33355358(+) A-I      intronic
chr8:33355437(+) A-I      intronic
chr8:33355150(+) A-I      intronic
chr8:33355110(+) A-I      intronic
chr8:33355209(+) A-I      intronic
chr8:33355413(+) A-I      intronic
chr8:33355030(+) A-I      intronic
chr8:33355264(+) A-I      intronic
chr8:33355192(+) A-I      intronic
chr8:33355432(+) A-I      intronic
chr8:33355186(+) A-I      intronic
chr8:33355427(+) A-I      intronic
chr8:33355069(+) A-I      intronic
chr8:33355364(+) A-I      intronic
chr8:33355438(+) A-I      intronic
chr8:33355359(+) A-I      intronic
chr8:33355435(+) A-I      intronic
chr8:33355418(+) A-I      intronic
chr8:33355404(+) A-I      intronic
chr8:33355428(+) A-I      intronic
chr8:33355195(+) A-I      intronic
chr8:33355212(+) A-I      intronic
chr8:33355140(+) A-I      intronic
chr8:33355176(+) A-I      intronic
chr8:33355137(+) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED MAK16
chr8:33355110(+) A-I intron -    22028664
chr8:33355111(+) A-I intron -    22028664
chr8:33355140(+) A-I intron -    22028664
chr8:33355150(+) A-I intron -    22028664
chr8:33355186(+) A-I intron -    22028664
chr8:33355192(+) A-I intron -    22028664
chr8:33355195(+) A-I intron -    22028664
chr8:33355209(+) A-I intron -    22028664
chr8:33355212(+) A-I intron -    22028664
chr8:33355231(+) A-I intron -    22028664
chr8:33355250(+) A-I intron -    22028664
chr8:33355251(+) A-I intron -    22028664
chr8:33355264(+) A-I intron -    22028664
chr8:33355281(+) A-I intron -    22028664
chr8:33355286(+) A-I intron -    22028664
chr8:33355358(+) A-I intron -    22028664
chr8:33355359(+) A-I intron -    22028664
chr8:33355364(+) A-I intron -    22028664
chr8:33355375(+) A-I intron -    22028664
chr8:33355394(+) A-I intron -    22028664
chr8:33355404(+) A-I intron -    22028664
chr8:33355413(+) A-I intron -    22028664
chr8:33355418(+) A-I intron -    22028664
chr8:33355427(+) A-I intron -    22028664
chr8:33355428(+) A-I intron -    22028664
chr8:33355432(+) A-I intron -    22028664
chr8:33355435(+) A-I intron -    22028664
chr8:33355437(+) A-I intron -    22028664
chr8:33355438(+) A-I intron -    22028664
chr8:33355456(+) A-I intron -    22028664
chr8:33355458(+) A-I intron -    22028664
chr8:33355461(+) A-I intron -    22028664
chr8:33355467(+) A-I intron -    22028664

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase MAK16
chr8:33342719-33342720(+) m6A 5'UTR//CDS//exon       24981863
chr8:33342801-33342802(+) m6A exon//intron       24981863
chr8:33345917-33345918(+) m6A CDS//exon       24284625//24981863
chr8:33346044-33346045(+) m6A CDS//exon       24284625//24981863
chr8:33346082-33346083(+) m6A CDS//exon       24284625//24981863
chr8:33346619-33346620(+) Y CDS//exon       26075521
chr8:33353087-33353088(+) m6A 3'UTR//CDS       27773535
chr8:33353118-33353119(+) m6A 3'UTR//CDS       27773535
chr8:33353124-33353125(+) m6A 3'UTR//CDS       27773535
chr8:33354192-33354193(+) m6A 3'UTR//CDS       24981863//27773535//22575960
chr8:33355960-33355961(+) m6A 3'UTR//CDS       24209618//24981863//27773535//22575960//22608085
chr8:33356038-33356039(+) m6A 3'UTR//CDS       24209618//24981863//27773535//22608085
chr8:33356065-33356066(+) m6A 3'UTR//CDS       24284625//24209618//24981863//27773535//22608085
chr8:33356114-33356115(+) m6A 3'UTR//CDS       24284625//24209618//24981863//27773535//22608085
chr8:33356138-33356139(+) m6A 3'UTR//CDS       24284625//24209618//24981863//27773535//22608085
chr8:33356173-33356174(+) m6A 3'UTR       24284625//24209618//24981863//27773535//22608085
chr8:33356178-33356179(+) m6A 3'UTR       24284625//24209618//24981863//27773535//22608085
chr8:33356187-33356188(+) m6A 3'UTR       24284625//24209618//24981863//27773535//22608085
chr8:33356214-33356215(+) m6A 3'UTR       24284625//24209618//24981863//27773535//22608085
chr8:33356257-33356258(+) m6A 3'UTR       24284625//24209618//24981863//27773535//22608085
chr8:33356338-33356339(+) m6A 3'UTR       27773535
chr8:33356390-33356391(+) m6A 3'UTR       27773535
chr8:33356487-33356488(+) m6A 3'UTR       27773535
chr8:33356721-33356722(+) m6A 3'UTR       27773535
chr8:33356792-33356793(+) m6A 3'UTR       27773535
chr8:33356800-33356801(+) m6A 3'UTR       27773535
chr8:33356807-33356808(+) m6A 3'UTR       27773535
chr8:33356812-33356813(+) m6A 3'UTR       27773535
chr8:33358582-33358583(+) m6A 3'UTR       27773535
chr8:33358630-33358631(+) m6A 3'UTR       27773535
chr8:33358678-33358679(+) m6A 3'UTR       27773535
chr8:33358685-33358686(+) m6A 3'UTR       27773535
chr8:33358696-33358697(+) m6A 3'UTR       27773535

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-519d-3p
Exosome Serum     18589210
Exosome Human mast cell line (HMC-1)     24009880
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Fibroblasts     -
MAK16
Chromatin K562 cells     -
Cytosol Human myelogenous leukemia cell line (K-562)     21613539
Exosome Blood     -
Nucleolus K562 cells     -
Nucleoplasm K562 cells     -
Nucleus K562 cells     -

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-519d-3p
Interactor2: MAK16

Evidence Support:


Weak-Evidence HITS-CLIP
Support Database ViRBase

References:


PMID 22473208 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line Jijoye cells Interactor2 expression None
Description Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).

Starting a new search, please wait ...