Basic Information:

  VIRBase ID:  

HHID00059666

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:  MIMAT0002853          BRMS1L:  NM_032352     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-519d-3p	BRMS1L
miRBase Accession/Entrez ID	MIMAT0002853	84312
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	BRMS1

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-519d-3p	rs1031566931 chr19:53713420    T/A rs116796400 chr19:53713416    A/G rs1177367352 chr19:53713409    T/A rs1362826944 chr19:53713419    G/T rs1443130720 chr19:53713413    T/A rs748935087 chr19:53713417    G/T rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA rs754470034 chr19:53713415    T/TACCAA rs754470034 chr19:53713415    T/TA rs754629979 chr19:53713421    G/T rs755601254 chr19:53713414    T/A rs752048127 chr19:53713406    G/T rs764695340 chr19:53713405    T/G

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	BRMS1L	chr14:36335790(+) A-I      intronic chr14:36305030(+) A-I      intronic chr14:36304847(+) A-I      intronic chr14:36306386(+) A-I      intronic chr14:36306382(+) A-I      intronic chr14:36316236(+) A-I      intronic chr14:36335745(+) A-I      intronic chr14:36306856(+) A-I      intronic chr14:36306886(+) A-I      intronic chr14:36306857(+) A-I      intronic chr14:36307021(+) A-I      intronic chr14:36326001(+) A-I      intronic chr14:36329359(+) A-I      intronic chr14:36306851(+) A-I      intronic chr14:36315062(+) A-I      intronic chr14:36305999(+) A-I      intronic chr14:36306000(+) A-I      intronic chr14:36315031(+) A-I      intronic chr14:36325841(+) A-I      intronic chr14:36328906(+) A-I      intronic chr14:36306285(+) A-I      intronic chr14:36306280(+) A-I      intronic chr14:36306013(+) A-I      intronic chr14:36306314(+) A-I      intronic chr14:36318444(+) A-I      intronic chr14:36325936(+) A-I      intronic chr14:36315522(+) A-I      intronic chr14:36335695(+) A-I      intronic chr14:36314982(+) A-I      intronic chr14:36306341(+) A-I      intronic chr14:36324480(+) A-I      intronic chr14:36298259(+) A-I      intronic chr14:36306788(+) A-I      intronic chr14:36325892(+) A-I      intronic chr14:36328925(+) A-I      intronic chr14:36315488(+) A-I      intronic

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	BRMS1L	chr14:36295755-36295756(+) m6A CDS//exon       24209618//25456834//24981863 chr14:36295783-36295784(+) m6A CDS//exon       24209618//25456834//24981863 chr14:36295822-36295823(+) m6A CDS//exon       24209618//24981863 chr14:36299081-36299082(+) m6A 3'UTR//intron       24981863 chr14:36299096-36299097(+) m6A 3'UTR//intron       24981863 chr14:36299104-36299105(+) m6A 3'UTR//intron       24981863 chr14:36300630-36300631(+) m6A 3'UTR//CDS//exon       24981863 chr14:36300682-36300683(+) m6A 3'UTR//CDS//exon       24981863 chr14:36302219-36302220(+) m6A 3'UTR//CDS//exon       24981863 chr14:36331833-36331834(+) m6A 3'UTR//CDS//exon       24981863 chr14:36337097-36337098(+) m6A exon//intron       24981863 chr14:36337121-36337122(+) m6A 3'UTR//CDS//exon       24981863 chr14:36337130-36337131(+) m6A 3'UTR//CDS//exon       24981863 chr14:36337163-36337164(+) m6A 3'UTR//CDS//exon       24981863 chr14:36340571-36340572(+) m6A 3'UTR//intron       -

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-519d-3p	Exosome Serum     18589210 Exosome Human mast cell line (HMC-1)     24009880 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Fibroblasts     -
	BRMS1L	Cytosol HCC cell line (HepG2)     - Exosome Blood     - Nucleoplasm K562 cells     - Nucleus HCC cell line (HepG2)     -

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-519d-3p
Interactor2: BRMS1L

Evidence Support:

Weak-Evidence	HITS-CLIP
Support Database	ViRBase

References:

PMID	22473208	Target region	3'UTR
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	Jijoye cells	Interactor2 expression	None
Description	Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).