Basic Information:

  VIRBase ID:  

HHID00059599

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:  MIMAT0002853          CROT:  NM_001243745     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-519d-3p	CROT
miRBase Accession/Entrez ID	MIMAT0002853	54677
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	COT

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-519d-3p	rs1031566931 chr19:53713420    T/A rs116796400 chr19:53713416    A/G rs1177367352 chr19:53713409    T/A rs1362826944 chr19:53713419    G/T rs1443130720 chr19:53713413    T/A rs748935087 chr19:53713417    G/T rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA rs754470034 chr19:53713415    T/TACCAA rs754470034 chr19:53713415    T/TA rs754629979 chr19:53713421    G/T rs755601254 chr19:53713414    T/A rs752048127 chr19:53713406    G/T rs764695340 chr19:53713405    T/G

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	CROT	chr7:86994555(+) A-I      intronic chr7:86985408(+) A-I      intronic chr7:86984699(+) A-I      intronic chr7:86984690(+) A-I      intronic chr7:86984533(+) A-I      intronic chr7:87001087(+) A-I      intronic chr7:86999556(+) A-I      intronic chr7:86999554(+) A-I      intronic chr7:87001098(+) A-I      intronic chr7:86999592(+) A-I      intronic chr7:87001148(+) A-I      intronic chr7:86999625(+) A-I      intronic chr7:87001195(+) A-I      intronic chr7:87001058(+) A-I      intronic chr7:86995067(+) A-I      intronic chr7:86985330(+) A-I      intronic chr7:86999761(+) A-I      intronic chr7:86985396(+) A-I      intronic chr7:86999734(+) A-I      intronic chr7:87028808(+) A-I      3'UTR chr7:87028672(+) A-I      3'UTR chr7:87028533(+) A-I      3'UTR chr7:86999632(+) A-I      intronic chr7:86999562(+) A-I      intronic chr7:87001205(+) A-I      intronic chr7:87001230(+) A-I      intronic chr7:86999560(+) A-I      intronic chr7:87001052(+) A-I      intronic chr7:86999599(+) A-I      intronic chr7:87001092(+) A-I      intronic chr7:86980356(+) A-I      intronic chr7:87001105(+) A-I      intronic chr7:87001155(+) A-I      intronic chr7:86999668(+) A-I      intronic chr7:87001235(+) A-I      intronic chr7:86999708(+) A-I      intronic chr7:86994991(+) A-I      intronic chr7:86995157(+) A-I      intronic chr7:86994993(+) A-I      intronic chr7:86994703(+) A-I      intronic chr7:87001152(+) A-I      intronic chr7:86999563(+) A-I      intronic chr7:86986177(+) A-I      intronic chr7:87001147(+) A-I      intronic chr7:87013087(+) A-I      intronic chr7:86999709(+) A-I      intronic

Resource	Symbol	Editing Position	Change	SeqReg	exReg	PMID
DARNED	CROT	chr7:87001052(+) A-I intron -    22327324 chr7:87001148(+) A-I intron -    21960545   //22327324 chr7:87001058(+) A-I intron -    21960545 chr7:86985330(+) A-G intron -    22484847 chr7:86986177(+) A-G intron -    22484847 chr7:86994703(+) A-G intron -    22484847 chr7:86994975(+) A-G intron -    22484847 chr7:86994993(+) A-G intron -    22484847 chr7:86995067(+) A-G intron -    22484847 chr7:86999562(+) A-G intron -    22484847 chr7:86999563(+) A-G intron -    22484847 chr7:86999599(+) A-G intron -    22484847 chr7:86999708(+) A-G intron -    22484847 chr7:86999709(+) A-G intron -    22484847 chr7:86999733(+) A-G intron -    22484847 chr7:86999734(+) A-G intron -    22484847 chr7:86999737(+) A-G intron -    22484847 chr7:87001051(+) A-G intron -    22484847 chr7:87001058(+) A-G intron -    22484847 chr7:87001091(+) A-G intron -    22484847 chr7:87001092(+) A-G intron -    22484847 chr7:87001098(+) A-G intron -    22484847 chr7:87001145(+) A-G intron -    22484847 chr7:87001147(+) A-G intron -    22484847 chr7:87001148(+) A-G intron -    22484847 chr7:87001173(+) A-G intron -    22484847 chr7:87001235(+) A-G intron -    22484847 chr7:87001265(+) A-G intron -    22484847

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	CROT	chr7:86975079-86975080(+) m6A 5'UTR       24981863 chr7:86975689-86975690(+) m6A 5'UTR       24981863

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-519d-3p	Exosome Serum     18589210 Exosome Human mast cell line (HMC-1)     24009880 Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     - Microvesicle Fibroblasts     -
	CROT	Cytosol HCC cell line (HepG2)     - Exosome Blood     - Nucleus HCC cell line (HepG2)     -

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-519d-3p
Interactor2: CROT

Evidence Support:

Weak-Evidence	HITS-CLIP
Support Database	ViRBase

References:

PMID	22473208	Target region	3'UTR
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	Jijoye cells	Interactor2 expression	None
Description	Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).