Detail Information

Basic Information:


  VIRBase ID:  

HHID00059425

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519d-3p:           JAK1:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-519d-3p JAK1
miRBase
Accession/Entrez ID		 MIMAT0002853 3716
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - AIIDE//JAK1A//JAK1B//JTK3

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-519d-3p
rs1031566931 chr19:53713420    T/A
rs116796400 chr19:53713416    A/G
rs1177367352 chr19:53713409    T/A
rs1362826944 chr19:53713419    G/T
rs1443130720 chr19:53713413    T/A
rs748935087 chr19:53713417    G/T
rs752635598 chr19:53713417    G/GTGTTACCCAAAGTGTTACCCAAACGTAACCCAA
rs754470034 chr19:53713415    T/TACCAA
rs754470034 chr19:53713415    T/TA
rs754629979 chr19:53713421    G/T
rs755601254 chr19:53713414    T/A
rs752048127 chr19:53713406    G/T
rs764695340 chr19:53713405    T/G

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR JAK1
chr1:65382439(-) A-I      intronic
chr1:65382457(-) A-I      intronic
chr1:65382476(-) A-I      intronic
chr1:65382275(-) A-I      intronic
chr1:65380495(-) A-I      intronic
chr1:65380366(-) A-I      intronic
chr1:65417546(-) A-I      intronic
chr1:65419595(-) A-I      intronic
chr1:65425889(-) A-I      intronic
chr1:65425692(-) A-I      intronic
chr1:65425688(-) A-I      intronic
chr1:65419481(-) A-I      intronic
chr1:65406164(-) A-I      intronic
chr1:65406160(-) A-I      intronic
chr1:65406148(-) A-I      intronic
chr1:65398013(-) A-I      intronic
chr1:65411609(-) A-I      intronic
chr1:65411677(-) A-I      intronic
chr1:65417506(-) A-I      intronic
chr1:65417536(-) A-I      intronic
chr1:65417537(-) A-I      intronic
chr1:65409716(-) A-I      intronic
chr1:65382522(-) A-I      intronic
chr1:65406223(-) A-I      intronic
chr1:65397930(-) A-I      intronic
chr1:65397913(-) A-I      intronic
chr1:65397893(-) A-I      intronic
chr1:65406203(-) A-I      intronic
chr1:65406193(-) A-I      intronic
chr1:65382518(-) A-I      intronic
chr1:65419630(-) A-I      intronic
chr1:65406188(-) A-I      intronic
chr1:65419631(-) A-I      intronic
chr1:65423259(-) A-I      intronic
chr1:65409741(-) A-I      intronic
chr1:65409866(-) A-I      intronic
chr1:65406739(-) A-I      intronic
chr1:65315058(-) A-I      intronic
chr1:65417596(-) A-I      intronic
chr1:65406804(-) A-I      intronic
chr1:65382426(-) A-I      intronic
chr1:65382473(-) A-I      intronic
chr1:65406725(-) A-I      intronic
chr1:65406735(-) A-I      intronic
chr1:65406097(-) A-I      intronic
chr1:65398060(-) A-I      intronic
chr1:65419467(-) A-I      intronic
chr1:65401230(-) A-I      intronic
chr1:65406613(-) A-I      intronic
chr1:65406128(-) A-I      intronic
chr1:65406588(-) A-I      intronic
chr1:65326387(-) A-I      intronic
chr1:65406242(-) A-I      intronic
chr1:65406110(-) A-I      intronic
chr1:65428741(-) A-I      intronic
chr1:65406631(-) A-I      intronic
chr1:65406127(-) A-I      intronic
chr1:65406096(-) A-I      intronic
chr1:65401202(-) A-I      intronic
chr1:65351414(-) A-I      intronic
chr1:65406682(-) A-I      intronic
chr1:65346554(-) A-I      intronic
chr1:65406685(-) A-I      intronic
chr1:65406676(-) A-I      intronic
chr1:65423505(-) A-I      intronic
chr1:65417728(-) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED JAK1
chr1:65346554(-) A-G intron -    22484847
chr1:65401230(-) A-G intron -    22484847
chr1:65406613(-) A-G intron -    22484847
chr1:65406631(-) A-G intron -    22484847
chr1:65406682(-) A-G intron -    22484847
chr1:65406685(-) A-G intron -    22484847
chr1:65406725(-) A-G intron -    22484847
chr1:65406735(-) A-G intron -    22484847
chr1:65411671(-) G-A intron -    22484847
chr1:65416064(-) G-A intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase JAK1
chr1:65299215-65299216(-) m6A 3'UTR       26404942
chr1:65299232-65299233(-) m6A 3'UTR       26404942
chr1:65299253-65299254(-) m6A 3'UTR       26404942
chr1:65299483-65299484(-) m6A 3'UTR       26404942//27773535
chr1:65299496-65299497(-) m6A 3'UTR       26404942//27773535
chr1:65299543-65299544(-) m6A 3'UTR       26404942//27773535
chr1:65299671-65299672(-) m6A 3'UTR       24284625//26404942//27773535
chr1:65299677-65299678(-) m6A 3'UTR       24284625//26404942//27773535
chr1:65299758-65299759(-) m6A 3'UTR       24284625//24981863//26404942//27773535//22608085
chr1:65299795-65299796(-) m6A 3'UTR       24284625//24981863//26404942//27773535//22608085
chr1:65300062-65300063(-) m6A 3'UTR       24284625//24981863//26404942//27773535//22608085
chr1:65300122-65300123(-) m6A 3'UTR       24284625//24981863//26404942//27773535//22608085
chr1:65300278-65300279(-) m6A CDS       26404942
chr1:65300291-65300292(-) m6A CDS       26404942
chr1:65303629-65303630(-) m6A CDS       26404942
chr1:65305320-65305321(-) m6A CDS//exon       26404942
chr1:65305335-65305336(-) m6A CDS//exon       26404942
chr1:65305431-65305432(-) m6A CDS//exon       26404942
chr1:65306979-65306980(-) m6A CDS       26404942
chr1:65306996-65306997(-) m6A CDS       26404942
chr1:65307156-65307157(-) m6A CDS//exon       26404942//27773535
chr1:65307201-65307202(-) m6A CDS//exon       26404942//27773535
chr1:65309762-65309763(-) m6A CDS//exon       26404942//27773535
chr1:65313239-65313240(-) m6A CDS//exon       26404942
chr1:65313282-65313283(-) m6A CDS//exon       26404942//27773535
chr1:65313312-65313313(-) m6A CDS//exon       26404942//27773535
chr1:65313330-65313331(-) m6A CDS//exon       26404942//27773535
chr1:65321277-65321278(-) m6A CDS       22575960
chr1:65321301-65321302(-) m6A CDS       22575960
chr1:65321349-65321350(-) m6A CDS       22575960
chr1:65330554-65330555(-) m6A CDS       24981863
chr1:65330575-65330576(-) m6A CDS       24981863
chr1:65330598-65330599(-) m6A CDS       24981863//27371828
chr1:65330610-65330611(-) m6A CDS       24981863//27371828
chr1:65330625-65330626(-) m6A CDS       24981863//26404942//27371828
chr1:65332554-65332555(-) m6A CDS       24981863//26404942//27371828
chr1:65332676-65332677(-) m6A CDS       24981863//26404942//27371828//22608085
chr1:65332701-65332702(-) m6A CDS       24981863//26404942//27371828//22608085
chr1:65332712-65332713(-) m6A CDS       24981863//26404942//27371828//22608085
chr1:65332775-65332776(-) m6A CDS       26404942//22608085
chr1:65332840-65332841(-) m6A CDS       26404942
chr1:65332848-65332849(-) m6A CDS       26404942
chr1:65332868-65332869(-) m6A CDS       26404942
chr1:65334999-65335000(-) m6A CDS       26404942
chr1:65335010-65335011(-) m6A CDS       26404942
chr1:65335094-65335095(-) m6A CDS       26404942
chr1:65335108-65335109(-) m6A CDS       26404942
chr1:65335116-65335117(-) m6A CDS       26404942
chr1:65339180-65339181(-) m6A CDS       27773535
chr1:65341688-65341689(-) m6A exon//intron       27773535
chr1:65349033-65349034(-) m6A CDS       26404942
chr1:65349081-65349082(-) m6A CDS       26404942
chr1:65349091-65349092(-) m6A CDS       26404942
chr1:65349138-65349139(-) m6A CDS       26404942
chr1:65432181-65432182(-) m6A 5'UTR       24981863//27773536

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-519d-3p
Exosome Serum     18589210
Exosome Human mast cell line (HMC-1)     24009880
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Fibroblasts     -
JAK1
Chromatin K562 cells     -
Cytosol Human myelogenous leukemia cell line (K-562)     21613539
Cytosol HeLa-S3 cells|K562 cells     -
Exosome Blood     -
Nucleolus K562 cells     -
Nucleoplasm K562 cells     -
Nucleus Colon cancer cells     24393600
Nucleus HCC cell line (HepG2)|K562 cells     -
Ribosome HEK-293 cells     22199352

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-519d-3p
Interactor2: JAK1

Evidence Support:


Weak-Evidence HITS-CLIP
Support Database ViRBase

References:


PMID 22473208 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line Jijoye cells Interactor2 expression None
Description Our HITS-CLIP data yield 1185 human 3'UTRs targeted by members of the miR-17~92 cluster in Jijoye cells. Comparison to the 1664 3'UTRs targeted by EBV miRNAs reveals 740 shared genes (44% of EBV targets and 62% of miR-17~92 targets; Figure 6B and Supplementary Table 7). Thus, EBV miRNAs co-target a majority of miR-17~92 regulated mRNAs, which are assigned to a variety of pathways, most notably regulating transcription, apoptosis, and the cell cycle (Figure 6C). Similarly, other abundant immunologically relevant miRNAs, 142-3p and miR-155, co-target with EBV miRNAs a large fraction of their Ago-bound 3'UTRs, representing ~60% of the targets for each of these host miRNAs (Supplementary Figure 5).

Starting a new search, please wait ...