Detail Information

Basic Information:


  VIRBase ID:  

HHID00057830

  Virus:  

Human gammaherpesvirus 4 (Epstein-Barr virus, EPV)

  Host:  

Homo sapiens

  Confidence Score:  

0.4752

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-425-3p:           PPP2CB:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-425-3p PPP2CB
miRBase
Accession/Entrez ID		 MIMAT0001343 5516
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - PP2Abeta//PP2CB

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-425-3p
rs1180702190 chr3:49020166    CACG/C
rs538769454 chr3:49020168    C/G
rs538769454 chr3:49020168    C/T
rs759535995 chr3:49020162    C/T
rs771779613 chr3:49020163    G/C
rs774483175 chr3:49020161    G/A
rs374899781 chr3:49020177    C/G
rs374899781 chr3:49020177    C/T
rs759930741 chr3:49020145    GCCGAAAGAGCACTGGGCGGACACGACATTC/G

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR PPP2CB
chr8:30661363(-) A-I      intronic
chr8:30661368(-) A-I      intronic
chr8:30661428(-) A-I      intronic
chr8:30661431(-) A-I      intronic
chr8:30661450(-) A-I      intronic
chr8:30649501(-) A-I      intronic
chr8:30649513(-) A-I      intronic
chr8:30662964(-) A-I      intronic
chr8:30661455(-) A-I      intronic
chr8:30663019(-) A-I      intronic
chr8:30661503(-) A-I      intronic
chr8:30661601(-) A-I      intronic
chr8:30662833(-) A-I      intronic
chr8:30662862(-) A-I      intronic
chr8:30663653(-) A-I      intronic
chr8:30663751(-) A-I      intronic
chr8:30663765(-) A-I      intronic
chr8:30663767(-) A-I      intronic
chr8:30663820(-) A-I      intronic
chr8:30660949(-) A-I      intronic
chr8:30665726(-) A-I      intronic
chr8:30665811(-) A-I      intronic
chr8:30666510(-) A-I      intronic
chr8:30666648(-) A-I      intronic
chr8:30666649(-) A-I      intronic
chr8:30667252(-) A-I      intronic
chr8:30667313(-) A-I      intronic
chr8:30667315(-) A-I      intronic
chr8:30667329(-) A-I      intronic
chr8:30667353(-) A-I      intronic
chr8:30667784(-) A-I      intronic
chr8:30667959(-) A-I      intronic
chr8:30667961(-) A-I      intronic
chr8:30669080(-) A-I      intronic
chr8:30669140(-) A-I      intronic
chr8:30669149(-) A-I      intronic
chr8:30669245(-) A-I      intronic
chr8:30663649(-) A-I      intronic
chr8:30658479(-) A-I      intronic
chr8:30660133(-) A-I      intronic
chr8:30658478(-) A-I      intronic
chr8:30658466(-) A-I      intronic
chr8:30665896(-) A-I      intronic
chr8:30649473(-) A-I      intronic
chr8:30649499(-) A-I      intronic
chr8:30652251(-) A-I      intronic
chr8:30660893(-) A-I      intronic
chr8:30660814(-) A-I      intronic
chr8:30661610(-) A-I      intronic
chr8:30661476(-) A-I      intronic
chr8:30663570(-) A-I      intronic
chr8:30662909(-) A-I      intronic
chr8:30661518(-) A-I      intronic
chr8:30666676(-) A-I      intronic
chr8:30667345(-) A-I      intronic
chr8:30660978(-) A-I      intronic
chr8:30665779(-) A-I      intronic
chr8:30669299(-) A-I      intronic
chr8:30661025(-) A-I      intronic
chr8:30667212(-) A-I      intronic
chr8:30667344(-) A-I      intronic
chr8:30667716(-) A-I      intronic
chr8:30661435(-) A-I      intronic
chr8:30660140(-) A-I      intronic
chr8:30667804(-) A-I      intronic
chr8:30667331(-) A-I      intronic
chr8:30665753(-) A-I      intronic
chr8:30666519(-) A-I      intronic
chr8:30660887(-) A-I      intronic
chr8:30667341(-) A-I      intronic
chr8:30658501(-) A-I      intronic
chr8:30667240(-) A-I      intronic
chr8:30665785(-) A-I      intronic
chr8:30646711(-) A-I      intronic
chr8:30669221(-) A-I      intronic
chr8:30667318(-) A-I      intronic
chr8:30669030(-) A-I      intronic
chr8:30661609(-) A-I      intronic
chr8:30665833(-) A-I      intronic
chr8:30667239(-) A-I      intronic
chr8:30661542(-) A-I      intronic
chr8:30663766(-) A-I      intronic
chr8:30669267(-) A-I      intronic
chr8:30667801(-) A-I      intronic
chr8:30667370(-) A-I      intronic
chr8:30660120(-) A-I      intronic
chr8:30667358(-) A-I      intronic
chr8:30661436(-) A-I      intronic
chr8:30660134(-) A-I      intronic
chr8:30665842(-) A-I      intronic
chr8:30665818(-) A-I      intronic
chr8:30660939(-) A-I      intronic
chr8:30663702(-) A-I      intronic
chr8:30662841(-) A-I      intronic
chr8:30667845(-) A-I      intronic
chr8:30660142(-) A-I      intronic
chr8:30661020(-) A-I      intronic
chr8:30661628(-) A-I      intronic
chr8:30661004(-) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED PPP2CB
chr8:30665887(-) A-I intron -    21960545
chr8:30660120(-) A-G intron -    22484847
chr8:30660142(-) A-G intron -    22484847
chr8:30660802(-) A-G intron -    22484847
chr8:30660866(-) A-G intron -    22484847
chr8:30660944(-) A-G intron -    22484847
chr8:30661004(-) A-G intron -    22484847
chr8:30661518(-) A-G intron -    22484847
chr8:30661596(-) A-G intron -    22484847
chr8:30661609(-) A-G intron -    22484847
chr8:30661610(-) A-G intron -    22484847
chr8:30662841(-) A-G intron -    22484847
chr8:30665718(-) T-C intron -    22484847
chr8:30665740(-) C-T intron -    22484847
chr8:30665753(-) A-G intron -    22484847
chr8:30665779(-) A-G intron -    22484847
chr8:30665818(-) A-G intron -    22484847
chr8:30665833(-) A-G intron -    22484847
chr8:30666657(-) A-G intron -    22484847
chr8:30666676(-) A-G intron -    22484847
chr8:30667239(-) A-G intron -    22484847
chr8:30667913(-) T-C intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase PPP2CB
chr8:30667513-30667514(-) m6A 5'UTR//intron       24209618
chr8:30667529-30667530(-) m6A 5'UTR//intron       24209618
chr8:30669860-30669861(-) m6A CDS//intron       24209618
chr8:30669905-30669906(-) m6A CDS//intron       24209618//24981863//27773535
chr8:30670057-30670058(-) m6A 5'UTR//intron       24209618//25456834//27371828//27773536
chr8:30670236-30670237(-) m6A 5'UTR//intron       24209618//25456834//24981863//27371828//27773536
chr8:30670318-30670319(-) m6A 5'UTR//CDS//intron       24209618//25456834//24981863//27371828//27773536
chr8:30670359-30670360(-) m6A 5'UTR//CDS//intron       24209618//25456834//24981863//27371828

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-425-3p
Exosome Plasma     23663360
Exosome Colon cancer cell line (LIM1863)     25330373
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Plasma     19002258
Microvesicle Plasma     23077538
Microvesicle Seminal plasma     23539611
Microvesicle Follicular fluid     23666971
Microvesicle Breast cell line|Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells     -
Mitochondrion Cell line (HEK-293|HeLa)     22984580
PPP2CB
Chromatin K562 cells     -
Cytosol Human myelogenous leukemia cell line (K-562)     21613539
Exosome Blood     -
Nucleoplasm K562 cells     -
Ribosome HEK-293 cells     22199352
Ribosome Colon cancer cells     24393600

Related Drug Information:


Resource Symbol Drug Name PubChem ID PMID
NoncoRNA hsa-miR-425-3p
Sorafenib 216239       25040368

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-425-3p
Interactor2: PPP2CB

Evidence Support:


Weak-Evidence PAR-CLIP
Support Database ViRBase

References:


PMID 22291592 Target region 3'UTR
Source ViRBase Interactor1 expression None
Tissue or cell line EF3D-AGO2 cells//LCL35 cells//LCL-BAC cells//LCL-BAC-D1 cells//LCL-BAC-D3 cells Interactor2 expression None
Description We identified 7, 827 miRNA-interaction sites in 3, 492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs.Table S6: High confidence miRNA-interaction sites in 3'UTRs.

Starting a new search, please wait ...