Basic Information:

  VIRBase ID:  

HHID00017071

  Virus:  

Zaire ebolavirus (ZEBOV)

  Host:  

Homo sapiens

  Confidence Score:  

0.5711

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-1307-5p:  MIMAT0022727          EPHA10:  NM_173641     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-1307-5p	EPHA10
miRBase Accession/Entrez ID	MIMAT0022727	284656
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	-

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-1307-5p	rs1309634229 chr10:103394348    C/CCGGTCGAGATTGGTACA rs1361155526 chr10:103394342    G/T rs1368355489 chr10:103394339    CGAGCCGGTCGA/C rs752308702 chr10:103394349    G/A rs753442502 chr10:103394342    GCCGGTCGAGGT/GCCGGTCGAGGTCCGGTCGAGGT rs753442502 chr10:103394342    GCCGGTCGAGGT/G rs758906629 chr10:103394350    A/AGGTCC rs762691771 chr10:103394351    G/A rs766738312 chr10:103394345    G/A rs766738312 chr10:103394345    G/C rs909057468 chr10:103394348    C/T rs1485833698 chr10:103394358    T/C rs745681690 chr10:103394354    C/T rs750389441 chr10:103394360    G/A rs750389441 chr10:103394360    G/C rs751122680 chr10:103394356    G/A rs757138030 chr10:103394359    C/G rs757138030 chr10:103394359    C/T rs763490878 chr10:103394355    C/G rs763490878 chr10:103394355    C/T

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	EPHA10	chr1:38198660(-) A-I      intronic chr1:38198759(-) A-I      intronic chr1:38214642(-) A-I      intronic chr1:38217158(-) A-I      intronic chr1:38199146(-) A-I      intronic chr1:38205233(-) A-I      intronic chr1:38198689(-) A-I      intronic chr1:38225372(-) A-I      intronic chr1:38214700(-) A-I      intronic chr1:38220567(-) A-I      intronic chr1:38211937(-) A-I      intronic chr1:38198656(-) A-I      intronic chr1:38198768(-) A-I      intronic chr1:38225449(-) A-I      intronic chr1:38205204(-) A-I      intronic chr1:38205278(-) A-I      intronic chr1:38198815(-) A-I      intronic chr1:38205342(-) A-I      intronic chr1:38198758(-) A-I      intronic chr1:38200098(-) A-I      intronic chr1:38213318(-) A-I      intronic chr1:38200106(-) A-I      intronic chr1:38211878(-) A-I      intronic chr1:38214733(-) A-I      intronic chr1:38198729(-) A-I      intronic chr1:38198604(-) A-I      intronic chr1:38225395(-) A-I      intronic chr1:38205249(-) A-I      intronic chr1:38206233(-) A-I      intronic chr1:38220330(-) A-I      intronic chr1:38222745(-) A-I      intronic chr1:38199971(-) A-I      intronic chr1:38220568(-) A-I      intronic chr1:38205647(-) A-I      intronic chr1:38220542(-) A-I      intronic chr1:38220292(-) A-I      intronic chr1:38198739(-) A-I      intronic chr1:38198991(-) A-I      intronic chr1:38214692(-) A-I      intronic chr1:38200203(-) A-I      intronic chr1:38205594(-) A-I      intronic chr1:38226673(-) A-I      3'UTR chr1:38205520(-) A-I      intronic chr1:38198661(-) A-I      intronic chr1:38222771(-) A-I      intronic chr1:38214732(-) A-I      intronic chr1:38217301(-) A-I      intronic chr1:38199090(-) A-I      intronic chr1:38211846(-) A-I      intronic chr1:38196406(-) A-I      intronic chr1:38214884(-) A-I      intronic chr1:38220763(-) A-I      intronic chr1:38191134(-) A-I      intronic chr1:38211845(-) A-I      intronic chr1:38200130(-) A-I      intronic chr1:38196426(-) A-I      intronic chr1:38215326(-) A-I      intronic chr1:38225428(-) A-I      intronic chr1:38213002(-) A-I      intronic chr1:38220286(-) A-I      intronic chr1:38217482(-) A-I      intronic chr1:38205644(-) A-I      intronic chr1:38200097(-) A-I      intronic chr1:38202891(-) A-I      intronic chr1:38196637(-) A-I      intronic chr1:38202027(-) A-I      intronic chr1:38216452(-) A-I      intronic chr1:38216491(-) A-I      intronic chr1:38199963(-) A-I      intronic chr1:38199147(-) A-I      intronic chr1:38216416(-) A-I      intronic

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-1307-5p	Exosome Plasma     23663360 Exosome Colon cancer cell line (LIM1863)     25330373 Exosome Blood|B lymphoblastoid cells|Chronic lymphocytic leukemia cells|Endothelial cells|Kidney tissue|Lymphoma tissue     - Microvesicle Serum     24797360 Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     -
	EPHA10	Exosome Blood     - Ribosome Colon cancer cells     24393600

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-1307-5p
Interactor2: EPHA10

Evidence Support:

Weak-Evidence	RNA-Seq
Prediction-Evidence	Targetscan
Support Database	ViRBase

References:

PMID	31570108	Target region	None
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	ARPE-19 human RPE cells	Interactor2 expression	None
Description	Table 1 List of miRNAs that were differentially expressed between EBOV- and mock-infected human RPE cells at 24 h post-infection.Putative target genes in EBOV-infected human RPE cells were predicted from the 15 highly differentially expressed miRNAs using algorithms: 2629 targets by Diana microT; 1799 targets by miRDB; and 14315 targets by TargetScan (Additional file 5).