Basic Information:

  VIRBase ID:  

HHID00017035

  Virus:  

Zaire ebolavirus (ZEBOV)

  Host:  

Homo sapiens

  Confidence Score:  

0.5711

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-1307-5p:  MIMAT0022727          GID8:  NM_017896     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-1307-5p	GID8
miRBase Accession/Entrez ID	MIMAT0022727	54994
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	C20orf11//TWA1

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-1307-5p	rs1309634229 chr10:103394348    C/CCGGTCGAGATTGGTACA rs1361155526 chr10:103394342    G/T rs1368355489 chr10:103394339    CGAGCCGGTCGA/C rs752308702 chr10:103394349    G/A rs753442502 chr10:103394342    GCCGGTCGAGGT/GCCGGTCGAGGTCCGGTCGAGGT rs753442502 chr10:103394342    GCCGGTCGAGGT/G rs758906629 chr10:103394350    A/AGGTCC rs762691771 chr10:103394351    G/A rs766738312 chr10:103394345    G/A rs766738312 chr10:103394345    G/C rs909057468 chr10:103394348    C/T rs1485833698 chr10:103394358    T/C rs745681690 chr10:103394354    C/T rs750389441 chr10:103394360    G/A rs750389441 chr10:103394360    G/C rs751122680 chr10:103394356    G/A rs757138030 chr10:103394359    C/G rs757138030 chr10:103394359    C/T rs763490878 chr10:103394355    C/G rs763490878 chr10:103394355    C/T

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	GID8	chr20:61571854(+) A-I      intronic chr20:61570395(+) A-I      intronic chr20:61573565(+) A-I      intronic

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	GID8	chr20:61572871-61572872(+) m6A CDS       24981863 chr20:61572936-61572937(+) m6A CDS       24981863 chr20:61572942-61572943(+) m6A CDS       24981863 chr20:61572957-61572958(+) m6A CDS       24981863 chr20:61574424-61574425(+) Am CDS       - chr20:61574882-61574883(+) m6A CDS       24981863 chr20:61575015-61575016(+) m6A CDS       24284625//24209618//22575960//22608085 chr20:61576149-61576150(+) m6A CDS       24284625//24209618//24981863//27773535//22575960//22608085 chr20:61576167-61576168(+) m6A CDS       24284625//24209618//24981863//27773535//22575960//22608085 chr20:61576196-61576197(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr20:61576229-61576230(+) m6A CDS       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr20:61576310-61576311(+) m6A 3'UTR       24284625//24209618//25456834//24981863//27773535//22575960//22608085 chr20:61576359-61576360(+) m6A 3'UTR       24284625//24209618//25456834//24981863//26404942//22575960//22608085 chr20:61576436-61576437(+) m6A 3'UTR       24284625//24209618//25456834//24981863//26404942//22575960//22608085 chr20:61576659-61576660(+) m6A 3'UTR       24284625//24209618//24981863 chr20:61576908-61576909(+) m6A 3'UTR       24209618 chr20:61576931-61576932(+) m6A 3'UTR       24209618 chr20:61577311-61577312(+) m6A 3'UTR       - chr20:61577380-61577381(+) m6A 3'UTR       - chr20:61577443-61577444(+) m6A 3'UTR       - chr20:61577700-61577701(+) m6A 3'UTR       -

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-1307-5p	Exosome Plasma     23663360 Exosome Colon cancer cell line (LIM1863)     25330373 Exosome Blood|B lymphoblastoid cells|Chronic lymphocytic leukemia cells|Endothelial cells|Kidney tissue|Lymphoma tissue     - Microvesicle Serum     24797360 Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     -
	GID8	Cytosol Human myelogenous leukemia cell line (K-562)     21613539 Exosome Blood     - Insoluble cytoplasm K562 cells     - Membrane HCC cell line (HepG2)     - Nucleolus K562 cells     - Nucleoplasm K562 cells     - Nucleus HCC cell line (HepG2)|HeLa-S3 cells     - Ribosome Colon cancer cells     24393600

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-1307-5p
Interactor2: GID8

Evidence Support:

Weak-Evidence	RNA-Seq
Prediction-Evidence	Targetscan
Support Database	ViRBase

References:

PMID	31570108	Target region	None
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	ARPE-19 human RPE cells	Interactor2 expression	None
Description	Table 1 List of miRNAs that were differentially expressed between EBOV- and mock-infected human RPE cells at 24 h post-infection.Putative target genes in EBOV-infected human RPE cells were predicted from the 15 highly differentially expressed miRNAs using algorithms: 2629 targets by Diana microT; 1799 targets by miRDB; and 14315 targets by TargetScan (Additional file 5).