Basic Information:

  VIRBase ID:  

HHID00016998

  Virus:  

Zaire ebolavirus (ZEBOV)

  Host:  

Homo sapiens

  Confidence Score:  

0.5711

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-1307-5p:  MIMAT0022727          SPIB:  NM_001243999     

      *It may take a few minutes to display results.

Interactor Information:

	Interactor1	Interactor2
Symbol	hsa-miR-1307-5p	SPIB
miRBase Accession/Entrez ID	MIMAT0022727	6689
Organism	Homo sapiens	Homo sapiens
Category	miRNA	mRNA
Alias	-	SPI-B

ncRNA SNP information:

Resource	Symbol	SNP ID	SNP Position	Ref/Alt
miRNASNP-v3	hsa-miR-1307-5p	rs1309634229 chr10:103394348    C/CCGGTCGAGATTGGTACA rs1361155526 chr10:103394342    G/T rs1368355489 chr10:103394339    CGAGCCGGTCGA/C rs752308702 chr10:103394349    G/A rs753442502 chr10:103394342    GCCGGTCGAGGT/GCCGGTCGAGGTCCGGTCGAGGT rs753442502 chr10:103394342    GCCGGTCGAGGT/G rs758906629 chr10:103394350    A/AGGTCC rs762691771 chr10:103394351    G/A rs766738312 chr10:103394345    G/A rs766738312 chr10:103394345    G/C rs909057468 chr10:103394348    C/T rs1485833698 chr10:103394358    T/C rs745681690 chr10:103394354    C/T rs750389441 chr10:103394360    G/A rs750389441 chr10:103394360    G/C rs751122680 chr10:103394356    G/A rs757138030 chr10:103394359    C/G rs757138030 chr10:103394359    C/T rs763490878 chr10:103394355    C/G rs763490878 chr10:103394355    C/T

RNA Editing:

Resource	Symbol	Editing Position	Change	Genetic Region
RADAR	SPIB	chr19:50929850(+) A-I      intronic chr19:50929939(+) A-I      intronic chr19:50929880(+) A-I      intronic chr19:50929896(+) A-I      intronic chr19:50929346(+) A-I      intronic chr19:50927923(+) A-I      intronic chr19:50927946(+) A-I      intronic chr19:50928203(+) A-I      intronic chr19:50928523(+) A-I      intronic chr19:50929974(+) A-I      intronic chr19:50928815(+) A-I      intronic chr19:50928827(+) A-I      intronic chr19:50928839(+) A-I      intronic chr19:50929932(+) A-I      intronic chr19:50928975(+) A-I      intronic chr19:50929290(+) A-I      intronic chr19:50929301(+) A-I      intronic chr19:50929316(+) A-I      intronic chr19:50929355(+) A-I      intronic chr19:50929453(+) A-I      intronic chr19:50929913(+) A-I      intronic chr19:50930222(+) A-I      intronic chr19:50930272(+) A-I      intronic chr19:50930643(+) A-I      intronic chr19:50927776(+) A-I      intronic chr19:50927891(+) A-I      intronic chr19:50928524(+) A-I      intronic chr19:50927679(+) A-I      intronic chr19:50929815(+) A-I      intronic chr19:50929426(+) A-I      intronic chr19:50930620(+) A-I      intronic chr19:50929877(+) A-I      intronic chr19:50929208(+) A-I      intronic chr19:50927725(+) A-I      intronic chr19:50929210(+) A-I      intronic chr19:50929987(+) A-I      intronic chr19:50928831(+) A-I      intronic chr19:50930125(+) A-I      intronic chr19:50928969(+) A-I      intronic chr19:50930032(+) A-I      intronic chr19:50927917(+) A-I      intronic chr19:50927959(+) A-I      intronic chr19:50930172(+) A-I      intronic chr19:50929868(+) A-I      intronic chr19:50929876(+) A-I      intronic chr19:50928364(+) A-I      intronic chr19:50930769(+) A-I      intronic chr19:50928845(+) A-I      intronic chr19:50928881(+) A-I      intronic chr19:50929935(+) A-I      intronic chr19:50930306(+) A-I      intronic chr19:50930185(+) A-I      intronic chr19:50930244(+) A-I      intronic chr19:50928883(+) A-I      intronic chr19:50930634(+) A-I      intronic chr19:50928409(+) A-I      intronic chr19:50927648(+) A-I      intronic chr19:50930661(+) A-I      intronic chr19:50929938(+) A-I      intronic chr19:50927649(+) A-I      intronic chr19:50928837(+) A-I      intronic chr19:50928363(+) A-I      intronic chr19:50927947(+) A-I      intronic chr19:50930131(+) A-I      intronic chr19:50927694(+) A-I      intronic chr19:50930266(+) A-I      intronic chr19:50927877(+) A-I      intronic chr19:50927895(+) A-I      intronic chr19:50928393(+) A-I      intronic chr19:50928775(+) A-I      intronic chr19:50928973(+) A-I      intronic chr19:50930727(+) A-I      intronic chr19:50927684(+) A-I      intronic chr19:50929351(+) A-I      intronic chr19:50930260(+) A-I      intronic chr19:50929961(+) A-I      intronic chr19:50930224(+) A-I      intronic chr19:50930205(+) A-I      intronic chr19:50928888(+) A-I      intronic chr19:50928446(+) A-I      intronic chr19:50928118(+) A-I      intronic chr19:50930726(+) A-I      intronic chr19:50927829(+) A-I      intronic chr19:50928420(+) A-I      intronic chr19:50929820(+) A-I      intronic chr19:50927983(+) A-I      intronic chr19:50928443(+) A-I      intronic

Resource	Symbol	Editing Position	Change	SeqReg	exReg	PMID
DARNED	SPIB	chr19:50933106(+) G-A intron -    21725310 chr19:50927829(+) A-G intron -    22484847 chr19:50927862(+) A-G intron -    22484847 chr19:50927895(+) A-G intron -    22484847 chr19:50927917(+) A-G intron -    22484847 chr19:50927947(+) A-G intron -    22484847 chr19:50927959(+) A-G intron -    22484847 chr19:50927983(+) A-G intron -    22484847 chr19:50928173(+) A-G intron -    22484847 chr19:50929426(+) A-G intron -    22484847 chr19:50930125(+) A-G intron -    22484847 chr19:50930185(+) A-G intron -    22484847 chr19:50930244(+) A-G intron -    22484847 chr19:50930661(+) A-G intron -    22484847

RNA Modification:

Resource	Symbol	ModificationPosition	Type	Genomic Context	PMID
RMBase	SPIB	chr19:50931351-50931352(+) m6A 3'UTR//CDS       25456834 chr19:50931421-50931422(+) m6A 3'UTR//CDS       25456834 chr19:50931456-50931457(+) m6A 3'UTR//CDS       - chr19:50931501-50931502(+) m6A 3'UTR//CDS       - chr19:50931512-50931513(+) m6A 3'UTR//CDS       - chr19:50931822-50931823(+) m6A 3'UTR       25456834//24981863 chr19:50931855-50931856(+) m6A 3'UTR       25456834//24981863 chr19:50931863-50931864(+) m6A 3'UTR       25456834//24981863 chr19:50931990-50931991(+) m6A 3'UTR       25456834 chr19:50933538-50933539(+) m6A 3'UTR       25456834 chr19:50933558-50933559(+) m6A 3'UTR       25456834 chr19:50933989-50933990(+) m6A 3'UTR       - chr19:50934010-50934011(+) m6A 3'UTR       - chr19:50934100-50934101(+) m6A 3'UTR       - chr19:50934155-50934156(+) m6A 3'UTR       -

RNA Localization:

Resource	Symbol	Subcellular Localization	Tissue or Cell Line	PMID
RNALocate	hsa-miR-1307-5p	Exosome Plasma     23663360 Exosome Colon cancer cell line (LIM1863)     25330373 Exosome Blood|B lymphoblastoid cells|Chronic lymphocytic leukemia cells|Endothelial cells|Kidney tissue|Lymphoma tissue     - Microvesicle Serum     24797360 Microvesicle Colon cancer cell line (LIM1863)|Fibroblasts|Mesenchymal stem cells|Urine     -
	SPIB	Endoplasmic reticulum Human myelogenous leukemia cell line (K-562)     21613539 Exosome Blood     -

Interaction Network (The top 100 interactions):

Interactor1: hsa-miR-1307-5p
Interactor2: SPIB

Evidence Support:

Weak-Evidence	RNA-Seq
Prediction-Evidence	Targetscan
Support Database	ViRBase

References:

PMID	31570108	Target region	None
Source	ViRBase	Interactor1 expression	None
Tissue or cell line	ARPE-19 human RPE cells	Interactor2 expression	None
Description	Table 1 List of miRNAs that were differentially expressed between EBOV- and mock-infected human RPE cells at 24 h post-infection.Putative target genes in EBOV-infected human RPE cells were predicted from the 15 highly differentially expressed miRNAs using algorithms: 2629 targets by Diana microT; 1799 targets by miRDB; and 14315 targets by TargetScan (Additional file 5).