Detail Information

Basic Information:


  VIRBase ID:  

HHID00005927

  Virus:  

Zaire ebolavirus (ZEBOV)

  Host:  

Homo sapiens

  Confidence Score:  

0.5711

  Interaction Type:  

Host-Host interaction

  Predicted Binding:

 

      hsa-miR-519e-3p:           SUN1:      

      *It may take a few minutes to display results.

Interactor Information:


Interactor1 Interactor2
Symbol hsa-miR-519e-3p SUN1
miRBase
Accession/Entrez ID
MIMAT0002829 23353
Organism Homo sapiens Homo sapiens
Category miRNA mRNA
Alias - UNC84A

ncRNA SNP information:


Resource Symbol SNP ID SNP Position Ref/Alt
miRNASNP-v3 hsa-miR-519e-3p
rs1320260913 chr19:53680012    T/TA
rs748109530 chr19:53680008    G/A
rs756692397 chr19:53679994    T/C
rs762638742 chr19:53679970    CTTTCTGTTTGAAAGAAAACAAAGTGCCTCCTTTTAGAGTG/C
rs778834695 chr19:53679997    C/T

RNA Editing:


Resource Symbol Editing Position Change Genetic Region
RADAR SUN1
chr7:909584(+) A-I      intronic
chr7:910203(+) A-I      intronic
chr7:910210(+) A-I      intronic
chr7:911094(+) A-I      intronic
chr7:911142(+) A-I      intronic
chr7:911166(+) A-I      intronic
chr7:911210(+) A-I      intronic
chr7:911268(+) A-I      intronic
chr7:911272(+) A-I      intronic
chr7:912603(+) A-I      intronic
chr7:912617(+) A-I      intronic
chr7:912630(+) A-I      intronic
chr7:886490(+) A-I      intronic
chr7:886485(+) A-I      intronic
chr7:886327(+) A-I      intronic
chr7:886274(+) A-I      intronic
chr7:886167(+) A-I      intronic
chr7:886118(+) A-I      intronic
chr7:885832(+) A-I      intronic
chr7:885815(+) A-I      intronic
chr7:885805(+) A-I      intronic
chr7:903938(+) A-I      intronic
chr7:904062(+) A-I      intronic
chr7:904446(+) A-I      intronic
chr7:904466(+) A-I      intronic
chr7:904540(+) A-I      intronic
chr7:877775(+) A-I      intronic
chr7:886553(+) A-I      intronic
chr7:873065(+) A-I      intronic
chr7:873051(+) A-I      intronic
chr7:873041(+) A-I      intronic
chr7:873012(+) A-I      intronic
chr7:873003(+) A-I      intronic
chr7:867658(+) A-I      intronic
chr7:865606(+) A-I      intronic
chr7:865760(+) A-I      intronic
chr7:865689(+) A-I      intronic
chr7:864961(+) A-I      intronic
chr7:911227(+) A-I      intronic
chr7:864910(+) A-I      intronic
chr7:885825(+) A-I      intronic
chr7:865666(+) A-I      intronic
chr7:886334(+) A-I      intronic
chr7:886335(+) A-I      intronic
chr7:903929(+) A-I      intronic
chr7:903935(+) A-I      intronic
chr7:903946(+) A-I      intronic
chr7:903960(+) A-I      intronic
chr7:903965(+) A-I      intronic
chr7:909732(+) A-I      intronic
chr7:909758(+) A-I      intronic
chr7:910103(+) A-I      intronic
chr7:910162(+) A-I      intronic
chr7:904862(+) A-I      intronic
chr7:904870(+) A-I      intronic
chr7:910179(+) A-I      intronic
chr7:910164(+) A-I      intronic
chr7:874619(+) A-I      intronic
chr7:897914(+) A-I      intronic
chr7:897912(+) A-I      intronic
chr7:886621(+) A-I      intronic
chr7:886591(+) A-I      intronic
chr7:886536(+) A-I      intronic
chr7:874615(+) A-I      intronic
chr7:905025(+) A-I      intronic
chr7:902632(+) A-I      intronic
chr7:886146(+) A-I      intronic
chr7:886416(+) A-I      intronic
chr7:911191(+) A-I      intronic
chr7:903999(+) A-I      intronic
chr7:886423(+) A-I      intronic
chr7:866887(+) A-I      intronic
chr7:886521(+) A-I      intronic
chr7:898629(+) A-I      intronic
chr7:865789(+) A-I      intronic
chr7:864884(+) A-I      intronic
chr7:865611(+) A-I      intronic
chr7:886499(+) A-I      intronic
chr7:910062(+) A-I      intronic
chr7:904500(+) A-I      intronic
chr7:885826(+) A-I      intronic
chr7:886153(+) A-I      intronic
chr7:886018(+) A-I      intronic
chr7:910051(+) A-I      intronic
chr7:885863(+) A-I      intronic
chr7:902555(+) A-I      intronic
chr7:865721(+) A-I      intronic
chr7:885946(+) A-I      intronic
chr7:873128(+) A-I      intronic
chr7:865819(+) A-I      intronic
chr7:886393(+) A-I      intronic
chr7:865625(+) A-I      intronic
chr7:886006(+) A-I      intronic
chr7:909581(+) A-I      intronic
chr7:909723(+) A-I      intronic
chr7:910125(+) A-I      intronic
chr7:886293(+) A-I      intronic
chr7:909826(+) A-I      intronic
chr7:885765(+) A-I      intronic
chr7:886468(+) A-I      intronic
chr7:910173(+) A-I      intronic
chr7:865618(+) A-I      intronic
chr7:885846(+) A-I      intronic
chr7:867364(+) A-I      intronic
chr7:909792(+) A-I      intronic
chr7:904991(+) A-I      intronic
chr7:888805(+) A-I      intronic
chr7:865777(+) A-I      intronic
chr7:886005(+) A-I      intronic
chr7:886262(+) A-I      intronic
chr7:864979(+) A-I      intronic
chr7:886137(+) A-I      intronic
chr7:864973(+) A-I      intronic
chr7:886331(+) A-I      intronic
chr7:864906(+) A-I      intronic
chr7:910071(+) A-I      intronic
chr7:886317(+) A-I      intronic
chr7:885845(+) A-I      intronic
chr7:864776(+) A-I      intronic
chr7:886570(+) A-I      intronic
chr7:910628(+) A-I      intronic
chr7:904071(+) A-I      intronic
chr7:865809(+) A-I      intronic
chr7:886494(+) A-I      intronic
chr7:886439(+) A-I      intronic
chr7:910041(+) A-I      intronic
chr7:904405(+) A-I      intronic
chr7:910708(+) A-I      intronic
chr7:886140(+) A-I      intronic
chr7:910138(+) A-I      intronic
chr7:865732(+) A-I      intronic
chr7:886540(+) A-I      intronic
chr7:865624(+) A-I      intronic
chr7:866861(+) A-I      intronic
chr7:886454(+) A-I      intronic
chr7:910108(+) A-I      intronic
chr7:866739(+) A-I      intronic
chr7:886298(+) A-I      intronic
chr7:910067(+) A-I      intronic
chr7:911207(+) A-I      intronic
chr7:886162(+) A-I      intronic
chr7:880540(+) A-I      intronic
chr7:909654(+) A-I      intronic
chr7:902560(+) A-I      intronic
chr7:911164(+) A-I      intronic
chr7:904925(+) A-I      intronic
chr7:886403(+) A-I      intronic
chr7:910148(+) A-I      intronic
chr7:886557(+) A-I      intronic
chr7:873210(+) A-I      intronic
chr7:885911(+) A-I      intronic
chr7:886089(+) A-I      intronic
chr7:886484(+) A-I      intronic
chr7:886576(+) A-I      intronic
chr7:886238(+) A-I      intronic
chr7:886257(+) A-I      intronic
chr7:912497(+) A-I      intronic
chr7:905022(+) A-I      intronic
chr7:912514(+) A-I      intronic
chr7:886410(+) A-I      intronic
chr7:886504(+) A-I      intronic
chr7:910133(+) A-I      intronic
chr7:909722(+) A-I      intronic
chr7:911125(+) A-I      intronic
chr7:911154(+) A-I      intronic
chr7:910237(+) A-I      intronic
chr7:910693(+) A-I      intronic
chr7:886132(+) A-I      intronic
chr7:886348(+) A-I      intronic
chr7:904983(+) A-I      intronic
chr7:909728(+) A-I      intronic
chr7:909645(+) A-I      intronic
chr7:898590(+) A-I      intronic
chr7:904449(+) A-I      intronic
chr7:904531(+) A-I      intronic
chr7:904884(+) A-I      intronic
Resource Symbol Editing Position Change SeqReg exReg PMID
DARNED SUN1
chr7:884665(+) A-I intron -    15342557
chr7:885765(+) A-I intron -    15342557
chr7:885846(+) A-I intron -    15342557
chr7:885863(+) A-I intron -    15342557
chr7:885875(+) A-I intron -    15342557
chr7:885887(+) A-I intron -    15342557
chr7:886005(+) A-I intron -    15342557
chr7:886018(+) A-I intron -    15342557
chr7:886229(+) A-I intron -    15342557
chr7:886257(+) A-I intron -    15342557
chr7:886331(+) A-I intron -    15342557   //22327324
chr7:886348(+) A-I intron -    15342557
chr7:886383(+) A-I intron -    15342557
chr7:886407(+) A-I intron -    15342557
chr7:886416(+) A-I intron -    15342557
chr7:886531(+) A-I intron -    15342557   //21960545
chr7:886566(+) A-I intron -    15342557
chr7:886570(+) A-I intron -    15342557   //22327324
chr7:886576(+) A-I intron -    15342557
chr7:890043(+) A-I intron -    22327324
chr7:865732(+) A-I intron -    21960545
chr7:889900(+) A-I intron -    21960545
chr7:864906(+) A-G intron -    22484847
chr7:865611(+) A-G intron -    22484847
chr7:865618(+) A-G intron -    22484847
chr7:865690(+) A-G intron -    22484847
chr7:865732(+) A-G intron -    22484847
chr7:865789(+) A-G intron -    22484847
chr7:867904(+) G-T intron -    22484847
chr7:880540(+) A-G intron -    22484847
chr7:885765(+) A-G intron -    22484847
chr7:885799(+) A-G intron -    22484847
chr7:885826(+) A-G intron -    22484847
chr7:885846(+) A-G intron -    22484847
chr7:885863(+) A-G intron -    22484847
chr7:885875(+) A-G intron -    22484847
chr7:885885(+) A-G intron -    22484847
chr7:885887(+) A-G intron -    22484847
chr7:885946(+) A-G intron -    22484847
chr7:886137(+) A-G intron -    22484847
chr7:886257(+) A-G intron -    22484847
chr7:886331(+) A-G intron -    22484847
chr7:886403(+) A-G intron -    22484847
chr7:886416(+) A-G intron -    22484847
chr7:886468(+) A-G intron -    22484847
chr7:886531(+) A-G intron -    22484847
chr7:886566(+) A-G intron -    22484847
chr7:886570(+) A-G intron -    22484847
chr7:890043(+) A-G intron -    22484847
chr7:902555(+) A-G intron -    22484847
chr7:903970(+) A-G intron -    22484847
chr7:904449(+) A-G intron -    22484847
chr7:904500(+) A-G intron -    22484847
chr7:904527(+) A-G intron -    22484847
chr7:904531(+) A-G intron -    22484847
chr7:910062(+) A-G intron -    22484847
chr7:910125(+) A-G intron -    22484847
chr7:910133(+) A-G intron -    22484847
chr7:910138(+) A-G intron -    22484847
chr7:910172(+) A-G intron -    22484847
chr7:910173(+) A-G intron -    22484847
chr7:910693(+) A-G intron -    22484847
chr7:911154(+) A-G intron -    22484847
chr7:912718(+) T-C intron -    22484847

RNA Modification:


Resource Symbol ModificationPosition Type Genomic Context PMID
RMBase SUN1
chr7:872159-872160(+) m6A 5'UTR//CDS//exon//intron       -
chr7:872213-872214(+) m6A 5'UTR//CDS//exon//intron       -
chr7:878484-878485(+) m6A 5'UTR//CDS//exon       -
chr7:881741-881742(+) m6A CDS//exon       24284625
chr7:881755-881756(+) m6A CDS//exon       24284625
chr7:882127-882128(+) m6A exon//intron       24284625
chr7:882133-882134(+) m6A exon//intron       24284625
chr7:882144-882145(+) m6A exon//intron       24284625
chr7:883142-883143(+) m6A CDS//exon//intron       24284625
chr7:893186-893187(+) Cm CDS//exon       -
chr7:912856-912857(+) m6A CDS//exon//intron       27773535
chr7:912886-912887(+) m6A CDS//exon//intron       24284625//24209618//27773535
chr7:912955-912956(+) m6A CDS//exon//intron       24284625//24209618//24981863//26404942//27773535//22575960//22608085
chr7:912970-912971(+) m6A 3'UTR//exon//intron       24284625//24209618//24981863//26404942//27773535//22575960//22608085
chr7:913010-913011(+) m6A 3'UTR//exon//intron       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085
chr7:913020-913021(+) m6A 3'UTR//exon//intron       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085
chr7:913062-913063(+) m6A 3'UTR//exon//intron       24284625//24209618//25456834//24981863//26404942//27773535//22575960//22608085
chr7:913198-913199(+) m6A 3'UTR//exon//intron       24284625//24209618//25456834//24981863//22608085
chr7:913213-913214(+) m6A 3'UTR//exon//intron       24284625//24209618//25456834//24981863//22608085
chr7:913344-913345(+) m6A 3'UTR//exon//intron       24981863//26404942
chr7:913404-913405(+) m6A 3'UTR//exon//intron       26404942
chr7:913433-913434(+) m6A 3'UTR//exon//intron       26404942
chr7:914411-914412(+) m6A 3'UTR//exon//intron       27773535
chr7:916423-916424(+) m6A intron       24284625//24209618
chr7:917756-917757(+) m6A intron       -
chr7:917849-917850(+) m6A intron       25456834
chr7:917905-917906(+) m6A intron       -
chr7:925169-925170(+) m6A intron       -
chr7:926744-926745(+) m6A intron       27371828
chr7:933435-933436(+) m6A 3'UTR       24284625
chr7:933552-933553(+) m6A 3'UTR       24284625
chr7:934973-934974(+) m6A 3'UTR       24284625//25456834//24981863//22608085
chr7:935054-935055(+) m6A 3'UTR       24284625//25456834//24981863//22575960//22608085
chr7:935059-935060(+) m6A 3'UTR       24284625//25456834//24981863//22575960//22608085
chr7:935079-935080(+) m6A 3'UTR       24284625//25456834//24981863//22575960//22608085
chr7:935246-935247(+) m6A 3'UTR       24284625//25456834//24981863//22575960
chr7:935475-935476(+) m6A 3'UTR       24284625//25456834//24981863
chr7:935531-935532(+) m6A 3'UTR       24284625//25456834//24981863
chr7:935559-935560(+) m6A 3'UTR       24284625//25456834
chr7:935757-935758(+) m6A 3'UTR       24981863

RNA Localization:


Resource Symbol Subcellular Localization Tissue or Cell Line PMID
RNALocate hsa-miR-519e-3p
Exosome Brain tissue     23382797
Exosome Breast milk|Cell lines|Epididymal epithelial cells|Osteoblast|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocyte|Saliva|Serum|Urine     -
Microvesicle Cell lines(GBM46|GBM8|HaCaT|K562|MCF-10A|MCF-7|MGG75)|Plasma|Primary glioblastoma neurosphere cells|Primary keratinocytes     -
SUN1
Chromatin K562 cells     -
Cytosol HCC cell line (HepG2)|K562 cells     -
Endoplasmic reticulum Human myelogenous leukemia cell line (K-562)     21613539
Exosome Blood     -
Membrane K562 cells     -
Nucleolus K562 cells     -
Nucleoplasm K562 cells     -
Nucleus Colon cancer cells     24393600
Nucleus HeLa-S3 cells|K562 cells     -

Related Drug Information:


Resource Symbol Drug Name PubChem
ID
Function
ncDR hsa-miR-519e-3p
Iodine Green 9956454 Drug sensitive
2-(2,4-Difluorophenyl)-4,5,6,7-tetrafluoro-1H-isoindole-1,3(2H)-dione 9905583 Drug sensitive
Kahalalide F 9898671 Drug resistant
CID 9604911 9604911 Drug sensitive
Actinomycin X4357G methoxime 9573583 Drug sensitive
Indolo[2,1-b]quinazoline-6,12-dione 73549 Drug sensitive
Venenatine 73061 Drug sensitive
Redoxal 72571 Drug sensitive
Piperidinium pentamethylenedithiocarbamate 72508 Drug sensitive
4-(2-Naphthylamino)phenol 7141 Drug sensitive
Tolonium chloride 7083 Drug sensitive
Sulbentine 67686 Drug sensitive
Reactive Blue 2 656725 Drug sensitive
(2R,3R,4S,5R)-2-(6-Benzylsulfanylpurin-9-yl)-5-(hydroxymethyl)oxolane-3,4-diol 6477178 Drug sensitive
Vicenistatin 6438888 Drug sensitive
Verrucarin A 6326658 Drug sensitive
Deferoxamine hydrochloride 62880 Drug sensitive
Cytarabine 6253 Drug sensitive
Bizelesin 60794 Drug sensitive
Tributyrin 6050 Drug sensitive
Triethylenemelamine 5799 Drug sensitive
Teclothiazide potassium 56841138 Drug sensitive
(3beta)-3-((4-O-beta-D Glucopyranosyl-beta-D-xylopyranosyl)oxy)-14-hydroxy-19-oxocarda-4,20(22)-dienolide 56840951 Drug sensitive
Caracemide 54747 Drug sensitive
7Z-Plakortide H 5472712 Drug sensitive
Artelasticin 5471311 Drug sensitive
Antineoplastic-690266 5469577 Drug sensitive
3-Deazauridine 54684286 Drug sensitive
3,19-(4-Acetamido)benzylidineandrographolide 54612901 Drug sensitive
Herveline O 5459269 Drug sensitive
Betuletol 5459196 Drug sensitive
Cuspidatin C 5459164 Drug sensitive
Thiram 5455 Drug sensitive
Piritrexim isethionate 54368 Drug sensitive
(E)-1-(2,5-Dihydroxyphenyl)ethene-2-isonitrile 5388136 Drug sensitive
(1E,4E)-1,5-Dipyridin-3-ylpenta-1,4-dien-3-one 5382674 Drug sensitive
Crassin, acetate 5355441 Drug sensitive
Rozex 5353923 Drug sensitive
MX2 hydrochloride 5351347 Drug sensitive
Dihydro-5-azacytidine 5351280 Drug sensitive
7-(3-Methoxyphenyl)-N-(pyridin-4-ylmethylideneamino)-5H-pyrrolo[3,2-d]pyrimidin-4-amine 53239944 Drug sensitive
Vorinostat 5311 Drug sensitive
Improsulfan hydrochloride 5284401 Drug sensitive
Kekule 499328 Drug sensitive
Pyrimethamine 4993 Drug sensitive
10-Hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12-dodecahydro-1H-picene-4a-carboxylic acid 495604 Drug sensitive
Propyl gallate 4947 Drug resistant
1,4-Benzoquinone 4650 Drug sensitive
Melphalan 460612 Drug sensitive
Aclarubicin 451415 Drug sensitive
Ossirene 451379 Drug sensitive
Mycophenolic acid 446541 Drug sensitive
1-(4-(Benzyloxy)phenyl)-3-(3-(1-ethyl-4-(1H-pyrrolo[2,3-b]pyridin-4-yl)-1H-pyrazol-3-yl)phenyl)urea 44587530 Drug sensitive
Isopinnatal 44558939 Drug sensitive
Iproplatin 44214 Drug sensitive
Di-n-octyl-secalonsaure A 430141 Drug sensitive
S-(Dimethylarsino)-3-mercapto-1,2-propyl dibenzoate 406481 Drug sensitive
Aminopyrimidine-CH3 406278 Drug sensitive
Mechlorethamine 4033 Drug sensitive
Artelastin 399488 Drug sensitive
Cbz-[Lys3]-Didemnin B 398464 Drug resistant
Loratadine 3957 Drug sensitive
2,5-Bis(aziridin-1-yl)-3-(hydroxymethyl)-6-methylcyclohexa-2,5-diene-1,4-dione 394347 Drug sensitive
Sjg-136 393111 Drug sensitive
Leflunomide 3899 Drug sensitive
beta-Lapachone 3885 Drug sensitive
Lapachol 3884 Drug sensitive
Benzo[1,2-b:5,4-b']dithiophene-4,8-dione, 2-acetyl- 388028 Drug sensitive
3-(4-Fluorophenyl)-3-(4-hydroxy-2-methylphenyl)-2-benzofuran-1(3H)-one 387973 Drug resistant
1,3-Diphenyl-6-((triphenylphosphoranylidene)amino)-2,4(1H,3H)-pyrimidinedione 387460 Drug sensitive
Acetic acid,4,7,10-tetraazacyclododecane-1,7-diyl]bis 387352 Drug sensitive
L-LYS-L-p-NO2Phe-L-Ala-L-p-NO2PheNH2 386384 Drug sensitive
Stereoisomer of NSC 674066-O 384359 Drug sensitive
3-(4-Fluorophenyl)-3-(4-acetoxy-2-methylphenyl)phthalide 383342 Drug resistant
1-Azido-2-phenyl-3-phenalenone 381891 Drug sensitive
2-Acetyl-1,2-dihydroellipticine 376328 Drug resistant
Sanguilutine pseudobase 371258 Drug sensitive
1,2-Dimethyl-phenothiazone 369387 Drug sensitive
4-Nitro-6-(trifluoromethyl)-2,1,3-benzoselenadiazole 362897 Drug sensitive
Aplidazole C . TFA 362402 Drug sensitive
Predorine 333830 Drug sensitive
Rocaglamide 331783 Drug sensitive
Pinafide 327045 Drug sensitive
2,3-Dimethoxy-5-naphthalen-2-ylsulfanylcyclohexa-2,5-diene-1,4-dione 314728 Drug sensitive
Cytosine, 1beta-D-arabinofuranosyl-N(sup 4)-stearoyl- 304673 Drug sensitive
Flurocitabine 3034016 Drug sensitive
P-Ara-C 282479 Drug sensitive
Dichloroallyl lawsone 277767 Drug sensitive
6-Bromotoyocamycin 270861 Drug sensitive
2'-Deoxy-5-(trifluoromethyl)uridine 253083 Drug sensitive
2-(7-Aminotriazolo[4,5-d]pyrimidin-3-yl)-5-(hydroxymethyl)oxolane-3,4-diol 251928 Drug sensitive
2-(4-Amino-1,2,5-oxadiazol-3-yl)-1-ethyl-N-[2-(methylamino)ethyl]-1H-imidazo[4,5-c]pyridine-7-carboxamide 25023715 Drug resistant
9H-Purine, 6-(o-chlorobenzylthio)-9-(2-chloroethyl)- 246231 Drug sensitive
9H-Purine, 6-(benzylthio)-9-(2-chloroethyl)- 246230 Drug sensitive
Antimycin A3 245869 Drug sensitive
Prumycin HCl 24197905 Drug resistant
Cinerubin A hcl 24196924 Drug sensitive
9H-Purine, 2-amino-6-(o-chlorobenzylthio)-9-propyl- 239486 Drug sensitive
Spongiaquinone 23424796 Drug resistant
[(1S,2Z,4R,8R,9R,11R,13S)-13-Acetyloxy-1-hydroxy-2,11-dimethyl-7-methylidene-6-oxo-5,14-dioxatricyclo[9.2.1.04,8]tetradec-2-en-9-yl] 2-methylpropanoate 23255746 Drug sensitive
Amsacrine 2179 Drug sensitive
Pirarubicin hydrochloride 20846247 Drug sensitive
7,8-Dihydroxyflavone 1880 Drug sensitive
Sudan II 18386 Drug sensitive
4-Chloro-5-phenoxy-3H-1,2-dithiole-3-thione 16766044 Drug sensitive
Azaribine 16574 Drug sensitive
(2Z,9E,13Z,15E)-4',11-Dihydroxy-2,4',9-trimethylspiro[3-aza-1(2,4)-thiazolacyclohexadecaphanene-6,3'-[1,2]dithiolane]-9,13,15-triene-4,5',12-trione 2'-oxide 154730760 Drug sensitive
Methyl (3'R)-3,4',9',10-tetrahydroxy-3'-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-7'-methoxy-5',8',9-trioxospiro[3,4-dihydropyrano[4,3-g]chromene-2,2'-3H-benzo[f][1]benzofuran]-7-carboxylate 137326876 Drug sensitive
C8, Carbonyl prodigiosine 135540857 Drug sensitive
5-[(E)-[Amino(methyl)amino]azo]-1H-imidazole-4-carboxamide 135493930 Drug sensitive
Cysteine, S-[(4-aminocarbonyl-1H-imidazol-5-yl)azo]- 135493928 Drug sensitive
Emofolin sodium 135475347 Drug sensitive
8-Azahypoxanthine 135410720 Drug sensitive
Raltitrexed 135400182 Drug sensitive
DTIC-Dome 135398738 Drug sensitive
(2S,4S,5R)-20-De(1-hydroxypropyl)-6-demethyl-2,6-diethyl-5-hydroxy-20-(1-hydroxybutyl)lysocellin 124081057 Drug sensitive
p-Toluquinone 11122 Drug sensitive
Gentian violet 11057 Drug sensitive
Withajardin C 102469053 Drug sensitive
(7S,9S)-7-[[(3As,4S,7aS)-1-[[(3aS,4S,7aS)-4-methyl-6-[[(1S,3S)-3,5,12-trihydroxy-3-(2-hydroxyacetyl)-10-methoxy-6,11-dioxo-2,4-dihydro-1H-tetracen-1-yl]oxy]-2,3a,4,6,7,7a-hexahydropyrano[4,3-d][1,3]oxazol-1-yl]methyl]-4-methyl-2,3a,4,6,7,7a-hexahydropyrano[4,3-d][1,3]oxazol-6-yl]oxy]-6,9,11-trihydroxy-9-(2-hydroxyacetyl)-4-methoxy-8,10-dihydro-7H-tetracene-5,12-dione 101713728 Drug sensitive
(1S,2R,4R,6S,11R,12S,15R,18S,19R,20R,21S,23R,26R)-15-Hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacont-8-ene-10,16,25,30-tetrone 101528280 Drug sensitive
Erigerol 101318126 Drug sensitive
[(1S,2S,4Z,8Z,12R,13S)-12-Hydroxy-4,8,12-trimethyl-16-methylidene-15-oxo-14-oxabicyclo[11.3.1]heptadeca-4,8-dien-2-yl] acetate 100921072 Drug sensitive
Tocladesine 100299 Drug sensitive
(1R,2E,6R,10E,11aS,13S,14aR)-6-(2-(benzyloxy)ethyl)-1,13-dihydroxy-6,7,8,9,12,13,14,14a-octahydro-1H-cyclopenta[f][1]oxacyclotridecin-4(11aH)-one - Drug resistant
2,3-dihydro-1,2-syn-3-[phenylseleno]brefeldin a - Drug resistant
9-methoxy-5-hydroxycamptothecin - Drug resistant
tp4ek - Drug resistant
(Z)-N-phenyl-3-(3,4,5-trimethoxystyryl)pyridin-2-amine - Drug sensitive
1,2-naphthoquinone, 3,7-dimethyl- - Drug sensitive
1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) - Drug sensitive
2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline - Drug sensitive
3',4',5'-trimethoxy-3-hydroxy flavone - Drug sensitive
4-(2-pyridinyl)-5h-1,2,3-dithiazole-5-thione - Drug sensitive
4-[3-(3,4-dihydro-1H-isoquinolin-2-yl)prop-1-en-2-yl]-N-pyrazin-2-ylbenzamide - Drug sensitive
4-quinazolone, 7-amino-3-(4-methoxyphenyl)-, hydrate - Drug sensitive
5.alpha.,25d-spirostan-3.beta.-ol glycoside - Drug sensitive
9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 5-methoxy- - Drug sensitive
acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) - Drug sensitive
b676297k277 3',4'-deoxypsorospermin 3',4'-chlorohydrin - Drug sensitive
benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine - Drug sensitive
benzofurazan, 4-nitro-7-(2-pyridinylthio)-, n-oxide - Drug sensitive
bersaldegenin 1,3,5-orthoacetate - Drug sensitive
cis-2-hydroxymethyl-4-(5'-bromocytosin-1'-yl)-1,3-dioxolane - Drug sensitive
furan-2(3h)-one, 5-(4-methylphenyl)-3,3-diphenyl- - Drug sensitive
isoflavone, 5,7-dihydroxy-4'-nitro- - Drug sensitive
mercury, tetrakis(acetato)(2,3,4,5-thiophenetetrayl)tetra- - Drug sensitive
n,n'-bis(oxydiethylene)thiocarbamoylsulfenamide - Drug sensitive
phenol, 4,4'-(5,5'-biisoxazole-3,3'-diyl)bis- - Drug sensitive
propan-1-one, 2,3-dichloro-1,3-bis(4-methylphenyl)- - Drug sensitive
propanedinitrile, [(3,5-dibromo-2-ethoxyphenyl)methylene]- - Drug sensitive
(Z)-3-((2-(4-(trifluoromethyl)phenyl)-3H-benzo[d]imidazol-5-yl)methylene)indolin-2-one - Drug sensitive
[bis(aminomethyl)diethylsilane]dichloroplatinum (ii) - Drug sensitive
7-propanoyltaxol - Drug sensitive
Aminopterin Derivative - Drug sensitive
Annamycin Liposomal - Drug sensitive
antineoplastic-d665839 - Drug sensitive
Camptothecin Derivative - Drug sensitive
Carboxyphthalatoplatinum - Drug sensitive
chlorobis(4-ethyltropolonato)bismuth(iii) - Drug sensitive
CI-921: amsacrine derivative - Drug sensitive
Indenoisoquinoline derivative - Drug sensitive
insulin-methotrexate conjugate - Drug sensitive
merophan - Drug sensitive
mitaplatin - Drug sensitive
n-myristoyl-(s)-phenylalaninal diethylcetal - Drug sensitive
organosulfur compound - Drug sensitive
trimethyl(phenylthio)stannane - Drug sensitive
Resource Symbol Drug Name PubChem
ID
Function Link  
RNAInter hsa-miR-519e-3p
Alocrest 60780 Drug interaction    RC00005536
5-Fluorouracil 3385 Drug interaction    RC00005535
cis-Diaminedichloroplatinum 2767 Drug interaction    RC00005534
Tamoxifen 2733526 Drug interaction    RC00005537

Interaction Network (The top 100 interactions):


Interactor1: hsa-miR-519e-3p
Interactor2: SUN1

Evidence Support:


Weak-Evidence RNA-Seq
Prediction-Evidence Targetscan
Support Database ViRBase

References:


PMID 31570108 Target region None
Source ViRBase Interactor1 expression None
Tissue or cell line ARPE-19 human RPE cells Interactor2 expression None
Description Table 1 List of miRNAs that were differentially expressed between EBOV- and mock-infected human RPE cells at 24 h post-infection.Putative target genes in EBOV-infected human RPE cells were predicted from the 15 highly differentially expressed miRNAs using algorithms: 2629 targets by Diana microT; 1799 targets by miRDB; and 14315 targets by TargetScan (Additional file 5).

Starting a new search, please wait ...