ncRNADetailInformation

Detail Information

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-92-1

MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000093	MIPF0000013	CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG	MIMAT0004507 hsa-miR-92a-1-5p	AGGUUGGGAUCGGUUGCAAUGCU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .
MI0000094	MIPF0000013	UCAUCCCUGGGUGGGGAUUUGUUGCAUUACUUGUGUUCUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGA	MIMAT0000092 hsa-miR-92a-3p	UAUUGCACUUGUCCCGGCCUGU	Human miR-92a (previously named miR-92 here) has two predicted hairpinprecursor sequences: mir-92a-1 (MIR:MI0000093) on chromosome 13 (namedmir-92-13 in ) and mir-92a-2 (MIR:MI0000094) on chromosome X (namedmir-92-X in ). miR-92a has also been cloned from mouse embryonic stemcells and is predicted to be expressed from two closely relatedprecursor hairpins (MIR:MI0000719 and MIR:MI0000580). The mature sequenceshown here represents the most commonly cloned form from large-scalecloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

KAT2B,GTPBP4,CDH1,TUBB,UBB,PLK1,MBLAC2,BMPR2,ITGA5,GATA5,BCL2L11,HIF1A,NARF,ZWINT,EEF2
more » KAT2B,GTPBP4,CDH1,TUBB,UBB,PLK1,MBLAC2,BMPR2,ITGA5,GATA5,BCL2L11,HIF1A,NARF,ZWINT,EEF2,RAD51,IQSEC1,RPL29,TP63,SLC2A4

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0010604	positive regulation of macromolecule metabolic process	BMPR2,PLK1,HIF1A,RAD51,TP63,UBB,GATA5,	6.09E-4
GO:0022402	cell cycle process	ZWINT,KAT2B,PLK1,TUBB,RAD51,UBB,	6.79E-4
GO:0007049	cell cycle	ZWINT,KAT2B,PLK1,TUBB,RAD51,UBB,	2.80E-2
GO:0033554	cellular response to stress	BMPR2,MRPS11,HIF1A,RAD51,TP63,	5.80E-2
GO:0031399	regulation of protein modification process	BMPR2,GTPBP4,PLK1,UBB,	6.57E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value