错误信息提示:
错误号：12142

错误原因：Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句：
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-424' and taxid like '10090'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
  • Functional analysis
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-424
MI0000590 MIPF0000164 CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA MIMAT0000548

mmu-miR-322-5p 		CAGCAGCAAUUCAUGUUUUGGA The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000590 MIPF0000164 CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA MIMAT0000548

mmu-miR-322-5p 		CAGCAGCAAUUCAUGUUUUGGA The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000590 MIPF0000164 CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA MIMAT0000548

mmu-miR-322-5p 		CAGCAGCAAUUCAUGUUUUGGA The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000590 MIPF0000164 CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA MIMAT0000548

mmu-miR-322-5p 		CAGCAGCAAUUCAUGUUUUGGA The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
MI0000590 MIPF0000164 CCUCGUUGACUCCGAAGGGCUGCAGCAGCAAUUCAUGUUUUGGAGUAUUGCCAAGGUUCAAAACAUGAAGCGCUGCAACACCCCUUCGUGGGGAA MIMAT0000548

mmu-miR-322-5p 		CAGCAGCAAUUCAUGUUUUGGA The mir-322 locus appears able to express two mature miRNA sequences. Poyet al. cloned a sequence originating from the 5' arm from mouse pancreaticbeta cells . This sequence is orthologous to the experimentallyvalidated miR-424 sequence from human (MIR:MI0001446), but was namedmiR-322-5p in . The mature product from the 3' arm of this precursorsequence is the predicted mouse homologue of miR-322, experimentallyverified in rat (MIR:MI0000589) , and later in mouse . Theorthologous human locus does not appear to contain the miR-322 sequence.Landgraf et al. confirm that the 5' product is the predominant one .The mature sequence shown here represents the most commonly cloned formfrom large-scale cloning studies .
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase
Arl2,Cdk6,Ccnd1
more » Arl2,Cdk6,Ccnd1
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
mmu04110 Cell cycle Cdk6,Ccnd1,Cdc25a, 4.93E-4
mmu05223 Non-small cell lung cancer Cdk6,Ccnd1, 1.87E-1
mmu05214 Glioma Cdk6,Ccnd1, 2.21E-1
mmu04115 p53 signaling pathway Cdk6,Ccnd1, 2.39E-1
mmu05218 Melanoma Cdk6,Ccnd1, 2.45E-1
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
GO:0007049 cell cycle Cdk6,Ccnd1,Cdc25a,Arl2, 9.04E-5
GO:0051301 cell division Cdk6,Ccnd1,Cdc25a, 1.26E-2
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value