ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-34c-5p

MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

SOX2,HNF4A,ULBP2,MYB,E2F3,AXL,MAPT,SRSF2,CDK4,MYCN,ZAP70,PARK7,MYC,ACSL1,CDK4PS
more » SOX2,HNF4A,ULBP2,MYB,E2F3,AXL,MAPT,SRSF2,CDK4,MYCN,ZAP70,PARK7,MYC,ACSL1,CDK4PS,CCNE2,NOTCH4,BMF,PARK2,NOTCH1,UNG,CAV1,NANOG,BCL2,MET

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05222	Small cell lung cancer	CCNE2,BCL2,CDK4,E2F3,MYC,	1.40E-4
hsa05200	Pathways in cancer	CCNE2,BCL2,CDK4,MET,E2F3,MYC,	3.51E-2
hsa04110	Cell cycle	CCNE2,CDK4,E2F3,MYC,	7.66E-2
hsa05219	Bladder cancer	CDK4,E2F3,MYC,	8.37E-2
hsa05218	Melanoma	CDK4,MET,E2F3,	2.28E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0008284	positive regulation of cell proliferation	ZAP70,SOX2,BCL2,NOTCH4,MYCN,NOTCH1,CDK4,E2F3,MYC,	3.43E-7
GO:0042127	regulation of cell proliferation	ZAP70,SOX2,HNF4A,BCL2,NOTCH4,MYCN,NOTCH1,CDK4,CAV1,E2F3,MYC,	3.89E-7
GO:0010604	positive regulation of macromolecule metabolic process	SOX2,HNF4A,BCL2,NOTCH4,NOTCH1,CDK4,CAV1,E2F3,MYC,	7.41E-5
GO:0048732	gland development	SOX2,BCL2,NOTCH4,CAV1,MET,	8.63E-5
GO:0048754	branching morphogenesis of a tube	BCL2,NOTCH4,MYCN,NOTCH1,	1.99E-4

GO:0010720	positive regulation of cell development	SOX2,BCL2,MAPT,NOTCH1,	2.38E-4
GO:0001763	morphogenesis of a branching structure	BCL2,NOTCH4,MYCN,NOTCH1,	2.92E-4
GO:0009991	response to extracellular stimulus	SOX2,ACSL1,BCL2,AXL,CAV1,	5.60E-4
GO:0045597	positive regulation of cell differentiation	ZAP70,SOX2,BCL2,MAPT,NOTCH1,	6.51E-4
GO:0010557	positive regulation of macromolecule biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	7.94E-4
GO:0031328	positive regulation of cellular biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	1.01E-2
GO:0009891	positive regulation of biosynthetic process	SOX2,HNF4A,NOTCH4,NOTCH1,CDK4,E2F3,MYC,	1.09E-2
GO:0030856	regulation of epithelial cell differentiation	NOTCH4,NOTCH1,CAV1,	1.18E-2
GO:0045893	positive regulation of transcription, DNA-dependent	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	1.30E-2
GO:0051094	positive regulation of developmental process	ZAP70,SOX2,BCL2,MAPT,NOTCH1,	1.34E-2
GO:0051254	positive regulation of RNA metabolic process	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	1.35E-2
GO:0035239	tube morphogenesis	BCL2,NOTCH4,MYCN,NOTCH1,	1.41E-2
GO:0045664	regulation of neuron differentiation	SOX2,BCL2,MAPT,NOTCH1,	1.61E-2
GO:0045165	cell fate commitment	SOX2,BCL2,NOTCH4,NOTCH1,	1.83E-2
GO:0007584	response to nutrient	SOX2,ACSL1,BCL2,CAV1,	1.87E-2
GO:0006355	regulation of transcription, DNA-dependent	SOX2,MYB,HNF4A,NOTCH4,MYCN,ATF1,NANOG,NOTCH1,E2F3,MYC,	2.29E-2
GO:0051726	regulation of cell cycle	CCNE2,HNF4A,BCL2,CDK4,MYC,	2.53E-2
GO:0051899	membrane depolarization	PARK7,BCL2,CAV1,	2.60E-2
GO:0051252	regulation of RNA metabolic process	SOX2,MYB,HNF4A,NOTCH4,MYCN,ATF1,NANOG,NOTCH1,E2F3,MYC,	2.68E-2
GO:0045941	positive regulation of transcription	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	2.72E-2
GO:0050767	regulation of neurogenesis	SOX2,BCL2,MAPT,NOTCH1,	3.03E-2
GO:0010628	positive regulation of gene expression	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	3.09E-2
GO:0019217	regulation of fatty acid metabolic process	ACSL1,HNF4A,CAV1,	3.37E-2
GO:0051934	catecholamine uptake during transmission of nerve impulse	PARK7,PARK2,	3.54E-2
GO:0051583	dopamine uptake	PARK7,PARK2,	3.54E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	4.20E-2
GO:0009612	response to mechanical stimulus	SOX2,CAV1,MYC,	4.38E-2
GO:0010565	regulation of cellular ketone metabolic process	ACSL1,HNF4A,CAV1,	4.53E-2
GO:0051960	regulation of nervous system development	SOX2,BCL2,MAPT,NOTCH1,	4.57E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	SOX2,HNF4A,NOTCH4,NOTCH1,E2F3,MYC,	4.81E-2
GO:0050769	positive regulation of neurogenesis	SOX2,MAPT,NOTCH1,	4.85E-2
GO:0031667	response to nutrient levels	SOX2,ACSL1,BCL2,CAV1,	4.91E-2
GO:0042524	negative regulation of tyrosine phosphorylation of Stat5 protein	HNF4A,CAV1,	5.31E-2
GO:0060284	regulation of cell development	SOX2,BCL2,MAPT,NOTCH1,	5.48E-2
GO:0030879	mammary gland development	NOTCH4,CAV1,MET,	5.51E-2
GO:0008361	regulation of cell size	HNF4A,BCL2,MAPT,CDK4,	5.56E-2
GO:0042493	response to drug	PARK7,ACSL1,BCL2,CAV1,	6.34E-2
GO:0045596	negative regulation of cell differentiation	SOX2,NOTCH4,NOTCH1,CAV1,	6.34E-2
GO:0031099	regeneration	BCL2,AXL,NOTCH1,	6.58E-2
GO:0035295	tube development	BCL2,NOTCH4,MYCN,NOTCH1,	6.67E-2
GO:0042325	regulation of phosphorylation	CCNE2,HNF4A,BCL2,CAV1,MET,	8.54E-2
GO:0015872	dopamine transport	PARK7,PARK2,	8.84E-2
GO:0051174	regulation of phosphorus metabolic process	CCNE2,HNF4A,BCL2,CAV1,MET,	9.80E-2
GO:0019220	regulation of phosphate metabolic process	CCNE2,HNF4A,BCL2,CAV1,MET,	9.80E-2
GO:0030534	adult behavior	PARK7,PARK2,MET,	1.00E-1

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value