ncRNADetailInformation

Detail Information

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-34

MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0000255 hsa-miR-34a-5p	UGGCAGUGUCUUAGCUGGUUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000268	MIPF0000039	GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC	MIMAT0004557 hsa-miR-34a-3p	CAAUCAGCAAGUAUACUGCCCU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Dostieet al. independently cloned this sequence in human but misnamed thesequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis). The sequence maps to human chromosome 1. Human miR-34a waspreviously named miR-34 here and in , but is renamed to clarifyhomology with the alternatively named mouse sequence (MIR:MI0000584). Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0000685 hsa-miR-34b-5p	UAGGCAGUGUCAUUAGCUGAUUG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0000686 hsa-miR-34c-5p	AGGCAGUGUAGUUAGCUGAUUGC	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.
MI0000742	MIPF0000039	GUGCUCGGUUUGUAGGCAGUGUCAUUAGCUGAUUGUACUGUGGUGGUUACAAUCACUAACUCCACUGCCAUCAAAACAAGGCAC	MIMAT0004676 hsa-miR-34b-3p	CAAUCACUAACUCCACUGCCAU	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences. Thepredominant mature miRNA in human is expressed from the 3' arm (incontrast to previous annotation) . Both arms express mature productsin mouse.
MI0000743	MIPF0000039	AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU	MIMAT0004677 hsa-miR-34c-3p	AAUCACUAACCACACGGCCAGG	Houbaviy et al. cloned 3 closely related sequences from mouse embryonicstem cells , and named them miR-34a, miR-34b and miR-172. These nameshave been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) andmiR-34a (MIR:MI0000584) to clarify homology with human sequences.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value