ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-224

MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0009198 hsa-miR-224-3p	AAAAUGGUGCCCUAGUGACUACA	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .
MI0000301	MIPF0000088	GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC	MIMAT0000281 hsa-miR-224-5p	CAAGUCACUAGUGGUUCCGUU	This miR was identified and ends mapped by cloning from Weri cells inhuman. The sequence maps to chromosome X. An erratum corrected theoriginally published name miR-175 to miR-224. The mature sequence shownhere represents the most commonly cloned form from large-scale cloningstudies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

CDH1,SMAD4,API5,CXCR4,FOSB,H3F3B,CDC42,PDGFRB,ADNP2,CD40,MAPK1,NIT1,SLMAP,KLK10,EYA4
more » CDH1,SMAD4,API5,CXCR4,FOSB,H3F3B,CDC42,PDGFRB,ADNP2,CD40,MAPK1,NIT1,SLMAP,KLK10,EYA4,AP2M1,DIO1,PAK2,SMAD5,PEBP1,NCOA6,ARSB,RAB9B,EDNRA

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa04520	Adherens junction	SMAD4,CDC42,CDH1,MAPK1,	8.56E-4
hsa05200	Pathways in cancer	BCL2,SMAD4,CDC42,PDGFRB,CDH1,MAPK1,	9.05E-4
hsa05210	Colorectal cancer	BCL2,SMAD4,PDGFRB,MAPK1,	1.10E-2
hsa04510	Focal adhesion	BCL2,PAK2,CDC42,PDGFRB,MAPK1,	1.27E-2
hsa04360	Axon guidance	CXCR4,PAK2,CDC42,MAPK1,	3.78E-2

hsa05211	Renal cell carcinoma	PAK2,CDC42,MAPK1,	1.32E-1
hsa05218	Melanoma	PDGFRB,CDH1,MAPK1,	1.35E-1
hsa05212	Pancreatic cancer	SMAD4,CDC42,MAPK1,	1.39E-1
hsa04810	Regulation of actin cytoskeleton	PAK2,CDC42,PDGFRB,MAPK1,	1.55E-1
hsa04350	TGF-beta signaling pathway	SMAD5,SMAD4,MAPK1,	1.99E-1
hsa05215	Prostate cancer	BCL2,PDGFRB,MAPK1,	2.08E-1
hsa04010	MAPK signaling pathway	PAK2,CDC42,PDGFRB,MAPK1,	2.76E-1
hsa04660	T cell receptor signaling pathway	PAK2,CDC42,MAPK1,	2.99E-1
hsa04722	Neurotrophin signaling pathway	BCL2,CDC42,MAPK1,	3.86E-1
hsa05216	Thyroid cancer	CDH1,MAPK1,	7.17E-1
hsa04144	Endocytosis	CXCR4,AP2M1,CDC42,	7.81E-1
hsa04062	Chemokine signaling pathway	CXCR4,CDC42,MAPK1,	8.04E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0042325	regulation of phosphorylation	EDNRA,BCL2,CXCR4,SMAD4,PAK2,CDC42,PDGFRB,PEBP1,	8.34E-6
GO:0051174	regulation of phosphorus metabolic process	EDNRA,BCL2,CXCR4,SMAD4,PAK2,CDC42,PDGFRB,PEBP1,	1.08E-5
GO:0019220	regulation of phosphate metabolic process	EDNRA,BCL2,CXCR4,SMAD4,PAK2,CDC42,PDGFRB,PEBP1,	1.08E-5
GO:0048754	branching morphogenesis of a tube	EDNRA,BCL2,CXCR4,SMAD4,	1.75E-4
GO:0001932	regulation of protein amino acid phosphorylation	EDNRA,BCL2,SMAD4,PDGFRB,PEBP1,	1.89E-4

GO:0001763	morphogenesis of a branching structure	EDNRA,BCL2,CXCR4,SMAD4,	2.57E-4
GO:0007281	germ cell development	BCL2,SMAD5,CXCR4,PEBP1,	6.41E-4
GO:0065003	macromolecular complex assembly	H3F3B,CD40,NCOA6,SMAD4,PAK2,CDH1,PEBP1,	6.78E-4
GO:0043933	macromolecular complex subunit organization	H3F3B,CD40,NCOA6,SMAD4,PAK2,CDH1,PEBP1,	9.57E-4
GO:0007610	behavior	BCL2,FOSB,CXCR4,PDGFRB,PEBP1,MAPK1,	9.82E-4
GO:0032268	regulation of cellular protein metabolic process	EDNRA,BCL2,SMAD4,PDGFRB,PEBP1,MAPK1,	1.03E-2
GO:0010033	response to organic substance	EDNRA,BCL2,NCOA6,CDH1,PEBP1,MAPK1,ARSB,	1.03E-2
GO:0035239	tube morphogenesis	EDNRA,BCL2,CXCR4,SMAD4,	1.24E-2
GO:0070271	protein complex biogenesis	CD40,NCOA6,SMAD4,PAK2,CDH1,PEBP1,	1.36E-2
GO:0006461	protein complex assembly	CD40,NCOA6,SMAD4,PAK2,CDH1,PEBP1,	1.36E-2
GO:0031399	regulation of protein modification process	EDNRA,BCL2,SMAD4,PDGFRB,PEBP1,	1.41E-2
GO:0001666	response to hypoxia	EDNRA,BCL2,CXCR4,SMAD4,	1.45E-2
GO:0032880	regulation of protein localization	CD40,BCL2,SMAD4,CDH1,	1.58E-2
GO:0045165	cell fate commitment	BCL2,SMAD5,SMAD4,CDC42,	1.61E-2
GO:0070482	response to oxygen levels	EDNRA,BCL2,CXCR4,SMAD4,	1.68E-2
GO:0046651	lymphocyte proliferation	CD40,BCL2,CXCR4,	2.28E-2
GO:0048610	reproductive cellular process	BCL2,SMAD5,CXCR4,PEBP1,	2.50E-2
GO:0032943	mononuclear cell proliferation	CD40,BCL2,CXCR4,	2.50E-2
GO:0070661	leukocyte proliferation	CD40,BCL2,CXCR4,	2.50E-2
GO:0010604	positive regulation of macromolecule metabolic process	EDNRA,CD40,BCL2,NCOA6,SMAD5,SMAD4,MAPK1,	2.52E-2
GO:0030334	regulation of cell migration	BCL2,CXCR4,PDGFRB,MAPK1,	2.82E-2
GO:0009725	response to hormone stimulus	BCL2,NCOA6,PEBP1,MAPK1,ARSB,	3.13E-2
GO:0001701	in utero embryonic development	EDNRA,NCOA6,PDGFRB,CDH1,	3.16E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	CD40,NCOA6,SMAD5,SMAD4,PEBP1,MAPK1,	3.96E-2
GO:0048545	response to steroid hormone stimulus	BCL2,PEBP1,MAPK1,ARSB,	4.04E-2
GO:0040012	regulation of locomotion	BCL2,CXCR4,PDGFRB,MAPK1,	4.04E-2
GO:0051270	regulation of cell motion	BCL2,CXCR4,PDGFRB,MAPK1,	4.10E-2
GO:0009719	response to endogenous stimulus	BCL2,NCOA6,PEBP1,MAPK1,ARSB,	4.46E-2
GO:0009636	response to toxin	BCL2,CDH1,PEBP1,	4.76E-2
GO:0030182	neuron differentiation	BCL2,CXCR4,SMAD4,CDC42,CDH1,	5.88E-2
GO:0035295	tube development	EDNRA,BCL2,CXCR4,SMAD4,	5.90E-2
GO:0032270	positive regulation of cellular protein metabolic process	EDNRA,BCL2,SMAD4,MAPK1,	6.92E-2
GO:0030097	hemopoiesis	BCL2,NCOA6,SMAD5,CDC42,	7.17E-2
GO:0051247	positive regulation of protein metabolic process	EDNRA,BCL2,SMAD4,MAPK1,	7.77E-2
GO:0042127	regulation of cell proliferation	EDNRA,CD40,BCL2,SMAD4,PDGFRB,MAPK1,	9.21E-2
GO:0048534	hemopoietic or lymphoid organ development	BCL2,NCOA6,SMAD5,CDC42,	9.35E-2
GO:0003006	reproductive developmental process	BCL2,SMAD5,CXCR4,PEBP1,	9.54E-2
GO:0001934	positive regulation of protein amino acid phosphorylation	EDNRA,BCL2,SMAD4,	9.89E-2
GO:0030335	positive regulation of cell migration	BCL2,PDGFRB,MAPK1,	9.89E-2
GO:0007389	pattern specification process	EDNRA,SMAD5,CXCR4,SMAD4,	1.00E-1

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value