ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-218

MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0000275 hsa-miR-218-5p	UUGUGCUUGAUCUAACCAUGU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .
MI0000294	MIPF0000026	GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGAGUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA	MIMAT0004565 hsa-miR-218-1-3p	AUGGUUCCGUCAAGCACCAUGG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. later verified the expression of miR-218 in human .
MI0000295	MIPF0000026	GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAUGGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA	MIMAT0004566 hsa-miR-218-2-3p	CAUGGUUCUGUCAAGCACCGCG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. Landgrafet al. confirm expression in human .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

ETS2,MAFG,ZC3H18,TTC33,PHC3,KIAA1462,BTBD7,NFE2L1,FOXO1,RPS13,KLHL13,LAMB3,SSH1,AGPAT5,BMI1
more » ETS2,MAFG,ZC3H18,TTC33,PHC3,KIAA1462,BTBD7,NFE2L1,FOXO1,RPS13,KLHL13,LAMB3,SSH1,AGPAT5,BMI1,NUP93,BIRC6,COL4A1,ZNF711,OLIG2,PXN,ATP6V0E1,LASP1,TOB1,NACC1,SP1,SERINC3,FOXN2,MBNL2,SBNO1,KLHL31,ROBO2,CENPO,ARSG,IKBKB,MKI67,EFNB2,FKBP1A,RIT1,CDKN1B,PRRC2C,ARL6,POGK,SLC38A1,VOPP1,GLCE,AKAP8,RARA,TPD52,ZNF407,ROBO1,STAM2,RICTOR,ACTN1,RNF38,HBS1L,RPL12,MLX,THOC2,TTC21B,SOST,PUM2,HECTD2,DKK2,BLCAP,MRPS27,PPIA,EBP,BTF3L4,PTPN11,DST,SREK1,LEF1,GJA1,SFRP2,TNIP2,CDK6,FAM13B,CAMTA1,DUSP18,SSR1,KATNAL1,CNTNAP2,MMP9,KLF9,BIRC5,RNF219,EARS2,EFNA1,SLC11A2,SLCO3A1,GPM6A,RPS25,RHBDD1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	CDK6,COL4A1,MMP9,LAMB3,FOXO1,LEF1,BIRC5,RARA,IKBKB,CDKN1B,	4.29E-4
hsa05222	Small cell lung cancer	CDK6,COL4A1,LAMB3,IKBKB,CDKN1B,	3.02E-2
hsa05220	Chronic myeloid leukemia	CDK6,PTPN11,IKBKB,CDKN1B,	1.67E-1
hsa05215	Prostate cancer	FOXO1,LEF1,IKBKB,CDKN1B,	2.62E-1
hsa04670	Leukocyte transendothelial migration	PTPN11,MMP9,PXN,ACTN1,	5.34E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0000902	cell morphogenesis	GJA1,PTPN11,LEF1,ROBO1,ROBO2,ARL6,SSH1,DST,	3.26E-2
GO:0032989	cellular component morphogenesis	GJA1,PTPN11,LEF1,ROBO1,ROBO2,ARL6,SSH1,DST,	5.90E-2
GO:0030097	hemopoiesis	CDK6,MMP9,BMI1,TPD52,EBP,SP1,	9.40E-2
GO:0030182	neuron differentiation	GJA1,PTPN11,ROBO1,ROBO2,CNTNAP2,OLIG2,DST,EFNA1,	9.90E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value