ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-212

MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0000269 hsa-miR-212-3p	UAACAGUCUCCAGUCACGGCC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0022695 hsa-miR-212-5p	ACCUUGGCUCUAGACUGCUUACU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0000269 hsa-miR-212-3p	UAACAGUCUCCAGUCACGGCC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0022695 hsa-miR-212-5p	ACCUUGGCUCUAGACUGCUUACU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0022695 hsa-miR-212-5p	ACCUUGGCUCUAGACUGCUUACU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0000269 hsa-miR-212-3p	UAACAGUCUCCAGUCACGGCC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0000269 hsa-miR-212-3p	UAACAGUCUCCAGUCACGGCC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0022695 hsa-miR-212-5p	ACCUUGGCUCUAGACUGCUUACU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.
MI0000288	MIPF0000065	CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC	MIMAT0000269 hsa-miR-212-3p	UAACAGUCUCCAGUCACGGCC	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the 5' end mapped by PCR. The 3' endwas not experimentally determined. The sequence maps to human chromosome17, but its expression has not been experimentally verified in human.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

TJP1,DPF1,EP300,PIK3R1,CCNA2,MECP2,ABCG2,TMEM106B,PEA15,BRCA1,RB1,PTCH1,CCNB1,FOXO3,PTEN
more » TJP1,DPF1,EP300,PIK3R1,CCNA2,MECP2,ABCG2,TMEM106B,PEA15,BRCA1,RB1,PTCH1,CCNB1,FOXO3,PTEN,EIF2C1,WT1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05215	Prostate cancer	PTEN,EP300,RB1,PIK3R1,	5.69E-4
hsa04110	Cell cycle	CCNA2,EP300,CCNB1,RB1,	1.53E-2
hsa05200	Pathways in cancer	PTEN,EP300,RB1,PIK3R1,PTCH1,	2.61E-2
hsa05213	Endometrial cancer	PTEN,FOXO3,PIK3R1,	4.38E-2
hsa05223	Non-small cell lung cancer	FOXO3,RB1,PIK3R1,	4.71E-2

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0009725	response to hormone stimulus	PTEN,CCNA2,BRCA1,EP300,PIK3R1,PTCH1,	4.88E-5
GO:0048545	response to steroid hormone stimulus	PTEN,CCNA2,BRCA1,EP300,PTCH1,	6.26E-5
GO:0009719	response to endogenous stimulus	PTEN,CCNA2,BRCA1,EP300,PIK3R1,PTCH1,	7.80E-5
GO:0043627	response to estrogen stimulus	PTEN,CCNA2,BRCA1,PTCH1,	2.36E-4
GO:0010604	positive regulation of macromolecule metabolic process	CCNA2,BRCA1,EP300,FOXO3,CCNB1,RB1,WT1,	2.93E-4

GO:0045941	positive regulation of transcription	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	3.68E-4
GO:0010628	positive regulation of gene expression	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	4.22E-4
GO:0051726	regulation of cell cycle	PTEN,CCNA2,BRCA1,CCNB1,RB1,	5.07E-4
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	5.86E-4
GO:0051173	positive regulation of nitrogen compound metabolic process	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	6.78E-4
GO:0010557	positive regulation of macromolecule biosynthetic process	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	7.27E-4
GO:0031328	positive regulation of cellular biosynthetic process	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	8.98E-4
GO:0009891	positive regulation of biosynthetic process	CCNA2,BRCA1,EP300,FOXO3,RB1,WT1,	9.59E-4
GO:0010033	response to organic substance	PTEN,CCNA2,BRCA1,EP300,PIK3R1,PTCH1,	1.13E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	MECP2,BRCA1,EP300,FOXO3,RB1,WT1,	1.17E-2
GO:0032355	response to estradiol stimulus	PTEN,CCNA2,PTCH1,	1.81E-2
GO:0042493	response to drug	PTEN,EP300,PTCH1,ABCG2,	1.92E-2
GO:0045893	positive regulation of transcription, DNA-dependent	BRCA1,EP300,FOXO3,RB1,WT1,	1.98E-2
GO:0051254	positive regulation of RNA metabolic process	BRCA1,EP300,FOXO3,RB1,WT1,	2.04E-2
GO:0010629	negative regulation of gene expression	MECP2,BRCA1,EIF2C1,RB1,WT1,	2.42E-2
GO:0010558	negative regulation of macromolecule biosynthetic process	MECP2,BRCA1,EIF2C1,RB1,WT1,	3.26E-2
GO:0031327	negative regulation of cellular biosynthetic process	MECP2,BRCA1,EIF2C1,RB1,WT1,	3.57E-2
GO:0009890	negative regulation of biosynthetic process	MECP2,BRCA1,EIF2C1,RB1,WT1,	3.85E-2
GO:0006915	apoptosis	PTEN,BRCA1,EP300,FOXO3,PEA15,	4.60E-2
GO:0012501	programmed cell death	PTEN,BRCA1,EP300,FOXO3,PEA15,	4.85E-2
GO:0000075	cell cycle checkpoint	CCNA2,BRCA1,RB1,	5.05E-2
GO:0045449	regulation of transcription	DPF1,MECP2,CCNA2,BRCA1,EP300,FOXO3,EIF2C1,RB1,WT1,	5.42E-2
GO:0006917	induction of apoptosis	DPF1,PTEN,BRCA1,FOXO3,	5.84E-2
GO:0012502	induction of programmed cell death	DPF1,PTEN,BRCA1,FOXO3,	5.89E-2
GO:0007281	germ cell development	FOXO3,CCNB1,WT1,	6.18E-2
GO:0043009	chordate embryonic development	BRCA1,EP300,TJP1,PTCH1,	6.41E-2
GO:0009792	embryonic development ending in birth or egg hatching	BRCA1,EP300,TJP1,PTCH1,	6.57E-2
GO:0008219	cell death	PTEN,BRCA1,EP300,FOXO3,PEA15,	8.62E-2
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	EP300,FOXO3,RB1,WT1,	8.78E-2
GO:0016265	death	PTEN,BRCA1,EP300,FOXO3,PEA15,	8.83E-2
GO:0010605	negative regulation of macromolecule metabolic process	MECP2,BRCA1,EIF2C1,RB1,WT1,	9.26E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value