错误信息提示:
错误号:12142

错误原因:Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句:
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-199a-5p' and taxid like '9606'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
  • Functional analysis
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-199a-5p
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281 MIPF0000040 AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA MIMAT0000231

hsa-miR-199a-5p
CCCAGUGUUCAGACUACCUGUUC Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase
ETS2,AXL,EZH2,HSPA5,TP53,PTGS2,ATG7,SMAD4,JUNB,LIF,CAV2,HIF1A,DDR1,MECP2,DRAM1
more » ETS2,AXL,EZH2,HSPA5,TP53,PTGS2,ATG7,SMAD4,JUNB,LIF,CAV2,HIF1A,DDR1,MECP2,DRAM1,SMARCA2,MAP3K11,SOX9,ERBB2,CCNL1,IKBKB,SIRT1,CD44,MED6,EDN1,UNG,BECN1,CAV1,MET,SULT1E1,GPR78
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
hsa05200 Pathways in cancer ERBB2,PTGS2,HIF1A,SMAD4,IKBKB,MET,TP53, 9.09E-4
hsa05212 Pancreatic cancer ERBB2,SMAD4,IKBKB,TP53, 2.24E-2
hsa05220 Chronic myeloid leukemia SMAD4,IKBKB,TP53, 3.12E-1
hsa04520 Adherens junction ERBB2,SMAD4,MET, 3.27E-1
hsa04510 Focal adhesion ERBB2,CAV2,CAV1,MET, 3.69E-1
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
GO:0042127 regulation of cell proliferation SMARCA2,ERBB2,PTGS2,HIF1A,CAV2,BECN1,CAV1,TP53,EDN1,LIF,SMAD4,DDR1,SIRT1,SOX9, 6.15E-9
GO:0031668 cellular response to extracellular stimulus AXL,BECN1,CAV1,HSPA5,SIRT1,TP53, 3.12E-7
GO:0009991 response to extracellular stimulus PTGS2,AXL,BECN1,CAV1,HSPA5,CD44,SIRT1,TP53, 5.15E-7
GO:0009267 cellular response to starvation BECN1,CAV1,HSPA5,SIRT1,TP53, 7.75E-7
GO:0008285 negative regulation of cell proliferation SMARCA2,ERBB2,PTGS2,SMAD4,CAV2,BECN1,CAV1,DDR1,TP53, 1.09E-6
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value