|
MI0000281
|
MIPF0000040
|
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA
|
MIMAT0000232
hsa-miR-199a-3p
|
ACAGUAGUCUGCACAUUGGUUA
|
Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
|
|
MI0000281
|
MIPF0000040
|
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA
|
MIMAT0000232
hsa-miR-199a-3p
|
ACAGUAGUCUGCACAUUGGUUA
|
Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
|
|
MI0000281
|
MIPF0000040
|
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA
|
MIMAT0000232
hsa-miR-199a-3p
|
ACAGUAGUCUGCACAUUGGUUA
|
Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
|
|
MI0000281
|
MIPF0000040
|
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA
|
MIMAT0000232
hsa-miR-199a-3p
|
ACAGUAGUCUGCACAUUGGUUA
|
Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
|