ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-199a

MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000232 hsa-miR-199a-3p	ACAGUAGUCUGCACAUUGGUUA	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .
MI0000281	MIPF0000040	AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA	MIMAT0000231 hsa-miR-199a-5p	CCCAGUGUUCAGACUACCUGUUC	Lagos-Quintana et al. cloned miR-199 from human osteoblast sarcomacells. They also reported identification of a miRNA from the opposite armin mouse cells. This sequence was named miR-199-s and the sequence fromthe 3' arm of the homologous mouse precursor miR-199-as. Lim et al. independently predicted this miRNA computationally using conservation withmouse and Fugu rubripes sequences . Expression of the miR excised fromthe 5' arm was validated in zebrafish, and the ends mapped by cloning. Theexcised miR sequences are renamed miR-199a (to avoid confusion with thesubsequently identified miR-199b (MIR:MI0000282)) and miR-199a* (from the3' arm) here. The two putative hairpin precursors in human map tochromosome 19 (mir-199a-1, MIR:MI0000242) and chromosome 1 (mir-199a-2,MIR:MI0000281). Landgraf et al. show that both mature products areexpressed, prompting the renaming to miR-199a-5p and miR-199a-3p .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

ETS2,AXL,EZH2,JUNB,MECP2,SOX9,KRT7,ERBB2,IKBKB,SIRT1,CD44,EDN1,MET,SULT1E1,GPR78
more » ETS2,AXL,EZH2,JUNB,MECP2,SOX9,KRT7,ERBB2,IKBKB,SIRT1,CD44,EDN1,MET,SULT1E1,GPR78,FUT4,PTGS2,SMAD4,LIF,CAV2,HIF1A,DDR1,MAPK1,SMARCA2,MAP3K11,MAPK9,CCNL1,MED6,UNG

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05200	Pathways in cancer	MAPK9,ERBB2,PTGS2,HIF1A,SMAD4,IKBKB,MET,MAPK1,	4.82E-5
hsa05212	Pancreatic cancer	MAPK9,ERBB2,SMAD4,IKBKB,MAPK1,	7.65E-5
hsa04510	Focal adhesion	MAPK9,ERBB2,CAV2,CAV1,MET,MAPK1,	3.85E-4
hsa04520	Adherens junction	ERBB2,SMAD4,MET,MAPK1,	1.94E-2
hsa05210	Colorectal cancer	MAPK9,SMAD4,MET,MAPK1,	2.50E-2

hsa04930	Type II diabetes mellitus	MAPK9,IKBKB,MAPK1,	1.04E-1
hsa04621	NOD-like receptor signaling pathway	MAPK9,IKBKB,MAPK1,	1.76E-1
hsa05120	Epithelial cell signaling in Helicobacter pylori infection	MAPK9,IKBKB,MET,	2.10E-1
hsa05211	Renal cell carcinoma	HIF1A,MET,MAPK1,	2.22E-1
hsa05220	Chronic myeloid leukemia	SMAD4,IKBKB,MAPK1,	2.53E-1
hsa04012	ErbB signaling pathway	MAPK9,ERBB2,MAPK1,	3.33E-1
hsa05215	Prostate cancer	ERBB2,IKBKB,MAPK1,	3.47E-1
hsa04620	Toll-like receptor signaling pathway	MAPK9,IKBKB,MAPK1,	4.37E-1
hsa04660	T cell receptor signaling pathway	MAPK9,IKBKB,MAPK1,	4.93E-1
hsa04010	MAPK signaling pathway	MAPK9,MAP3K11,IKBKB,MAPK1,	5.63E-1
hsa04722	Neurotrophin signaling pathway	MAPK9,IKBKB,MAPK1,	6.31E-1
hsa04910	Insulin signaling pathway	MAPK9,IKBKB,MAPK1,	7.33E-1
hsa04320	Dorso-ventral axis formation	ETS2,MAPK1,	8.04E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0042127	regulation of cell proliferation	SMARCA2,ERBB2,PTGS2,HIF1A,CAV2,CAV1,EDN1,LIF,SMAD4,SIRT1,DDR1,SOX9,MAPK1,	2.86E-8
GO:0010628	positive regulation of gene expression	MED6,MAPK9,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,MAPK1,JUNB,	2.16E-6
GO:0051173	positive regulation of nitrogen compound metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,MAPK1,JUNB,	5.04E-6
GO:0010604	positive regulation of macromolecule metabolic process	MED6,MAPK9,SMARCA2,LIF,HIF1A,SMAD4,ETS2,CAV1,SOX9,MAPK1,JUNB,	6.54E-6
GO:0031328	positive regulation of cellular biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,MAPK1,JUNB,	8.33E-6

GO:0030879	mammary gland development	ERBB2,CAV2,CAV1,MET,DDR1,	9.29E-6
GO:0009891	positive regulation of biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,EDN1,SOX9,MAPK1,JUNB,	9.36E-6
GO:0007243	protein kinase cascade	MAPK9,ERBB2,MAP3K11,IKBKB,CAV1,MET,EDN1,MAPK1,	1.00E-5
GO:0045941	positive regulation of transcription	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,MAPK1,JUNB,	1.71E-5
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,MAPK1,JUNB,	3.55E-5
GO:0048545	response to steroid hormone stimulus	ERBB2,PTGS2,CAV2,CAV1,MAPK1,JUNB,	4.92E-5
GO:0010557	positive regulation of macromolecule biosynthetic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,MAPK1,JUNB,	4.96E-5
GO:0045893	positive regulation of transcription, DNA-dependent	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	5.15E-5
GO:0051254	positive regulation of RNA metabolic process	MED6,SMARCA2,LIF,HIF1A,SMAD4,ETS2,SOX9,JUNB,	5.43E-5
GO:0006468	protein amino acid phosphorylation	MAPK9,ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,MAPK1,	5.70E-5
GO:0010647	positive regulation of cell communication	ERBB2,LIF,PTGS2,HIF1A,SMAD4,CAV2,CAV1,	5.85E-5
GO:0032504	multicellular organism reproduction	ERBB2,LIF,PTGS2,CAV2,CAV1,MET,SIRT1,JUNB,	5.87E-5
GO:0048609	reproductive process in a multicellular organism	ERBB2,LIF,PTGS2,CAV2,CAV1,MET,SIRT1,JUNB,	5.87E-5
GO:0007517	muscle organ development	ERBB2,LIF,CAV2,CAV1,MET,SIRT1,	7.70E-5
GO:0043408	regulation of MAPKKK cascade	ERBB2,LIF,MAP3K11,CAV1,EDN1,	8.10E-5
GO:0007565	female pregnancy	LIF,SULT1E1,PTGS2,DDR1,JUNB,	8.40E-5
GO:0042493	response to drug	ERBB2,PTGS2,CAV2,IKBKB,CAV1,JUNB,	8.60E-5
GO:0045596	negative regulation of cell differentiation	EZH2,LIF,CAV1,SIRT1,SOX9,MAPK1,	8.60E-5
GO:0008285	negative regulation of cell proliferation	SMARCA2,ERBB2,PTGS2,SMAD4,CAV2,CAV1,DDR1,	9.78E-5
GO:0006357	regulation of transcription from RNA polymerase II promoter	MED6,SMARCA2,LIF,MECP2,HIF1A,SMAD4,SIRT1,SOX9,JUNB,	1.04E-4
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	MED6,SMARCA2,LIF,HIF1A,SMAD4,SOX9,JUNB,	1.13E-4
GO:0010627	regulation of protein kinase cascade	ERBB2,LIF,MAP3K11,IKBKB,CAV1,EDN1,	1.67E-4
GO:0048732	gland development	ERBB2,CAV2,CAV1,MET,DDR1,	1.85E-4
GO:0016310	phosphorylation	MAPK9,ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,MAPK1,	2.03E-4
GO:0042981	regulation of apoptosis	MAPK9,ERBB2,PTGS2,MAP3K11,IKBKB,CD44,SIRT1,SOX9,MAPK1,	2.10E-4
GO:0043405	regulation of MAP kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	2.19E-4
GO:0043067	regulation of programmed cell death	MAPK9,ERBB2,PTGS2,MAP3K11,IKBKB,CD44,SIRT1,SOX9,MAPK1,	2.25E-4
GO:0010941	regulation of cell death	MAPK9,ERBB2,PTGS2,MAP3K11,IKBKB,CD44,SIRT1,SOX9,MAPK1,	2.31E-4
GO:0001890	placenta development	LIF,PTGS2,HIF1A,JUNB,	2.79E-4
GO:0046697	decidualization	LIF,PTGS2,JUNB,	3.41E-4
GO:0009967	positive regulation of signal transduction	ERBB2,LIF,HIF1A,SMAD4,CAV2,CAV1,	3.68E-4
GO:0042325	regulation of phosphorylation	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	3.91E-4
GO:0032268	regulation of cellular protein metabolic process	LIF,SMAD4,MAP3K11,CAV1,KRT7,EDN1,MAPK1,	4.28E-4
GO:0001893	maternal placenta development	LIF,PTGS2,JUNB,	4.57E-4
GO:0001932	regulation of protein amino acid phosphorylation	LIF,SMAD4,MAP3K11,CAV1,EDN1,	4.77E-4
GO:0051174	regulation of phosphorus metabolic process	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	4.84E-4
GO:0019220	regulation of phosphate metabolic process	ERBB2,LIF,SMAD4,MAP3K11,CAV1,MET,EDN1,	4.84E-4
GO:0000165	MAPKKK cascade	MAPK9,MAP3K11,CAV1,MET,MAPK1,	6.02E-4
GO:0010033	response to organic substance	ERBB2,PTGS2,CAV2,CAV1,CD44,DDR1,MAPK1,JUNB,	6.60E-4
GO:0051172	negative regulation of nitrogen compound metabolic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	6.92E-4
GO:0007167	enzyme linked receptor protein signaling pathway	ERBB2,LIF,AXL,SMAD4,MET,DDR1,	7.22E-4
GO:0006796	phosphate metabolic process	MAPK9,ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,MAPK1,	7.64E-4
GO:0006793	phosphorus metabolic process	MAPK9,ERBB2,AXL,CAV2,MAP3K11,IKBKB,MET,DDR1,MAPK1,	7.64E-4
GO:0046777	protein amino acid autophosphorylation	ERBB2,CAV2,MAP3K11,MET,	7.77E-4
GO:0032570	response to progesterone stimulus	ERBB2,CAV1,JUNB,	8.23E-4
GO:0009725	response to hormone stimulus	ERBB2,PTGS2,CAV2,CAV1,MAPK1,JUNB,	9.92E-4
GO:0031327	negative regulation of cellular biosynthetic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	1.04E-2
GO:0033554	cellular response to stress	MAPK9,UNG,HIF1A,MAP3K11,CAV1,SIRT1,MAPK1,	1.08E-2
GO:0009890	negative regulation of biosynthetic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	1.16E-2
GO:0009991	response to extracellular stimulus	PTGS2,AXL,CAV1,CD44,SIRT1,	1.17E-2
GO:0044093	positive regulation of molecular function	ERBB2,HIF1A,MAP3K11,IKBKB,CAV1,MET,EDN1,	1.30E-2
GO:0043406	positive regulation of MAP kinase activity	ERBB2,MAP3K11,MET,EDN1,	1.31E-2
GO:0045597	positive regulation of cell differentiation	MAPK9,LIF,HIF1A,SMAD4,JUNB,	1.36E-2
GO:0043627	response to estrogen stimulus	PTGS2,CAV2,CAV1,MAPK1,	1.43E-2
GO:0045449	regulation of transcription	SMARCA2,EZH2,MECP2,HIF1A,IKBKB,JUNB,MED6,LIF,SMAD4,ETS2,CCNL1,SIRT1,MAPK1,SOX9,	1.46E-2
GO:0009719	response to endogenous stimulus	ERBB2,PTGS2,CAV2,CAV1,MAPK1,JUNB,	1.53E-2
GO:0007595	lactation	CAV2,CAV1,MET,	1.62E-2
GO:0008284	positive regulation of cell proliferation	ERBB2,LIF,PTGS2,HIF1A,EDN1,MAPK1,	1.69E-2
GO:0001568	blood vessel development	HIF1A,CAV1,CD44,EDN1,JUNB,	1.74E-2
GO:0007566	embryo implantation	LIF,PTGS2,DDR1,	1.85E-2
GO:0001944	vasculature development	HIF1A,CAV1,CD44,EDN1,JUNB,	1.90E-2
GO:0001936	regulation of endothelial cell proliferation	HIF1A,CAV2,CAV1,	2.11E-2
GO:0003006	reproductive developmental process	LIF,PTGS2,SIRT1,SOX9,JUNB,	2.23E-2
GO:0014033	neural crest cell differentiation	HIF1A,EDN1,SOX9,	2.24E-2
GO:0014032	neural crest cell development	HIF1A,EDN1,SOX9,	2.24E-2
GO:0019229	regulation of vasoconstriction	PTGS2,CAV1,EDN1,	2.38E-2
GO:0006355	regulation of transcription, DNA-dependent	MED6,EZH2,SMARCA2,LIF,MECP2,HIF1A,SMAD4,ETS2,SIRT1,SOX9,JUNB,	2.73E-2
GO:0051094	positive regulation of developmental process	MAPK9,LIF,HIF1A,SMAD4,JUNB,	2.76E-2
GO:0001666	response to hypoxia	HIF1A,SMAD4,CAV1,EDN1,	2.87E-2
GO:0006940	regulation of smooth muscle contraction	PTGS2,CAV1,EDN1,	2.97E-2
GO:0006928	cell motion	ERBB2,PTGS2,HIF1A,CAV2,CD44,MET,	3.08E-2
GO:0051252	regulation of RNA metabolic process	MED6,EZH2,SMARCA2,LIF,MECP2,HIF1A,SMAD4,ETS2,SIRT1,SOX9,JUNB,	3.23E-2
GO:0070482	response to oxygen levels	HIF1A,SMAD4,CAV1,EDN1,	3.32E-2
GO:0031399	regulation of protein modification process	LIF,SMAD4,MAP3K11,CAV1,EDN1,	3.42E-2
GO:0010605	negative regulation of macromolecule metabolic process	SMARCA2,MECP2,SMAD4,CAV1,SIRT1,EDN1,SOX9,	4.05E-2
GO:0051495	positive regulation of cytoskeleton organization	CAV2,CAV1,EDN1,	4.14E-2
GO:0045934	negative regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	SMARCA2,MECP2,SMAD4,SIRT1,EDN1,SOX9,	4.25E-2
GO:0001765	membrane raft formation	CAV2,CAV1,	4.28E-2
GO:0043085	positive regulation of catalytic activity	ERBB2,HIF1A,MAP3K11,CAV1,MET,EDN1,	4.54E-2
GO:0051241	negative regulation of multicellular organismal process	PTGS2,CAV1,EDN1,SOX9,	5.07E-2
GO:0051726	regulation of cell cycle	LIF,PTGS2,CAV2,EDN1,JUNB,	5.15E-2
GO:0048762	mesenchymal cell differentiation	HIF1A,EDN1,SOX9,	5.30E-2
GO:0014031	mesenchymal cell development	HIF1A,EDN1,SOX9,	5.30E-2
GO:0060485	mesenchyme development	HIF1A,EDN1,SOX9,	5.50E-2
GO:0010558	negative regulation of macromolecule biosynthetic process	SMARCA2,MECP2,SMAD4,SIRT1,EDN1,SOX9,	5.63E-2
GO:0035150	regulation of tube size	CAV2,CAV1,EDN1,	5.71E-2
GO:0050880	regulation of blood vessel size	CAV2,CAV1,EDN1,	5.71E-2
GO:0045859	regulation of protein kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	5.96E-2
GO:0048771	tissue remodeling	ERBB2,HIF1A,CAV1,	6.36E-2
GO:0045892	negative regulation of transcription, DNA-dependent	SMARCA2,MECP2,SMAD4,SIRT1,SOX9,	6.65E-2
GO:0051130	positive regulation of cellular component organization	SMAD4,CAV2,CAV1,EDN1,	6.66E-2
GO:0043549	regulation of kinase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	6.72E-2
GO:0003018	vascular process in circulatory system	CAV2,CAV1,EDN1,	6.80E-2
GO:0051253	negative regulation of RNA metabolic process	SMARCA2,MECP2,SMAD4,SIRT1,SOX9,	7.05E-2
GO:0008015	blood circulation	PTGS2,CAV2,CAV1,EDN1,	7.18E-2
GO:0003013	circulatory system process	PTGS2,CAV2,CAV1,EDN1,	7.18E-2
GO:0051338	regulation of transferase activity	ERBB2,MAP3K11,CAV1,MET,EDN1,	7.75E-2
GO:0031668	cellular response to extracellular stimulus	AXL,CAV1,SIRT1,	8.23E-2
GO:0031667	response to nutrient levels	PTGS2,CAV1,CD44,SIRT1,	8.41E-2
GO:0048754	branching morphogenesis of a tube	SMAD4,CD44,EDN1,	8.48E-2
GO:0032909	regulation of transforming growth factor-beta2 production	HIF1A,SMAD4,	8.54E-2
GO:0060538	skeletal muscle organ development	ERBB2,CAV2,CAV1,	8.74E-2
GO:0007519	skeletal muscle tissue development	ERBB2,CAV2,CAV1,	8.74E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value