错误信息提示:
错误号：12142

错误原因：Table 'hscellor_ncrdeathdb.ncrnadeathmiRNA2targetDB' doesn't exist

错误sql语句：
select * from ncrnadeathmiRNA2targetDB where mirnaSymbol like '%miR-16-1' and taxid like '9606'
——错误记录被保存!

ncRNADetailInformation
  • Detail Information
  • Functional analysis
miRNA namepre-miRNA familypre-miRNA Sequencemature-miRNAmature sequencepre-miRNA description
miR-16-1
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
MI0000070 MIPF0000006 GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC MIMAT0004489

hsa-miR-16-1-3p 		CCAGUAUUAACUGUGCUGCUGA Human miR-16 has been cloned by independent groups [1,2]. This precursorsequence maps to chromosome 13, and was named mir-16 in andmir-16-precursor-13 in . Lim et al. reported 2 identical chromosome 13loci, which appear to map to the same locus in subsequent genomeassemblies. This gene and miR-15a are clustered within 0.5 kb at 13q14.This region has been shown to be deleted in more than half of B cellchronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deletedor down-regulated in more than two thirds of CLL cases . A secondputative mir-16 hairpin precursor is located on chromosome 3(MIR:MI0000738).
link to database TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0
Interacted genes from RAID,miRTarBase
ZYX,CCND1
more » ZYX,CCND1
KEGG pathways enriched for interacted genes
pathway namepathway descriptiontarget genes enrich in pathwayp-value
hsa04510 Focal adhesion CCND1,BCL2,ZYX, 1.55E-2
hsa05222 Small cell lung cancer CCND1,BCL2, 3.27E-1
hsa05210 Colorectal cancer CCND1,BCL2, 3.27E-1
hsa05215 Prostate cancer CCND1,BCL2, 3.47E-1
Gene ontology terms enriched for interacted genes
GO termsGO terms descriptiontarget genes enrich in GO termp-value
GO:0010039 response to iron ion CCND1,BCL2, 1.77E-2
GO:0051412 response to corticosterone stimulus CCND1,BCL2, 2.36E-2
GO:0051385 response to mineralocorticoid stimulus CCND1,BCL2, 2.95E-2
GO:0008584 male gonad development CCND1,BCL2, 7.67E-2
GO:0000082 G1/S transition of mitotic cell cycle CCND1,BCL2, 8.26E-2
KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.
disease namerelated genesp-value