ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-15a

MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0004488 hsa-miR-15a-3p	CAGGCCAUAUUGUGCUGCCUCA	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .
MI0000069	MIPF0000006	CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAAGG	MIMAT0000068 hsa-miR-15a-5p	UAGCAGCACAUAAUGGUUUGUG	Reference named this sequence miR-15. This is renamed miR-15a here toavoid confusion with miR-15b (MIR:MI0000438) identified later by others.This gene and miR-16 are clustered within 0.5 kb at 13q14. This regionhas been shown to be deleted in more than half of B cell chroniclymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted ordown-regulated in more than two thirds of CLL cases .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

RECK,FASN,PLA2G2D,CNN3,PMS1,HSP90B1,BACE1,ADORA2B,SLC35B3,C2orf74,NT5DC1,VEGFA,ODC1,FOXO1,HDHD2
more » RECK,FASN,PLA2G2D,CNN3,PMS1,HSP90B1,BACE1,ADORA2B,SLC35B3,C2orf74,NT5DC1,VEGFA,ODC1,FOXO1,HDHD2,ND4L,IFNG,CLCN3,LEPROTL1,SEC63,TTC1,H3F3B,BMI1,ELN,GDI2,MSH2,ANAPC16,RSPO2,NAB1,ACVR1B,TRIM28,HACE1,PURA,ATP6AP1,CDC14B,CADM1,PDHX,GCLM,GOLGA5,TFAM,PTAR1,CNOT6,HSPA1A,APP,CCND1,AKT3,MAPK6,BTRC,ASXL2,GTF2H1,UGP2,UCP2,HRSP12,OMA1,FAM122C,FAM69A,RASAL2,CHUK,DHX57,RHOT1,PRDX3,NOP2,NFKB1,RAB9B,DMTF1,BCL2,WIPF1,KIF1A,C17orf80,WT1,TMEM214,CCNYL1,CCNE1,ZNF559,RNASEL,PDCD4,MYB,IKBKG,MN1,RGPD5,HIST1H2BK,WNT3A,TP53,DSTYK,PDCD6IP,PRIM1,HERC6,CCND2,CABIN1,PCMT1,RAD51C,SKAP2,BRWD1,CLCC1,PCF11,VPS45,CARD8,SLC35A1,SNX6,MCL1,JUN,CDC25A,CREBL2,RPP30,RAB21,CEP63,ATF2,TPI1,FBXO3,CALD1,MYBL1,BRCA1,OSGEPL1,PREB,DLK1,ASNSD1,PSMC4,ACTR1A,CHD4,PHKB,HSDL2,TSPYL2,CRKL,PNN,CENPJ,TMEM184B,UGDH,TIA1,C14orf109,CCT6B,ECHDC1,CIAO1

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05215	Prostate cancer	CCND1,IKBKG,BCL2,AKT3,CHUK,FOXO1,NFKB1,CCNE1,HSP90B1,TP53,	1.18E-7
hsa05200	Pathways in cancer	JUN,CCND1,WNT3A,IKBKG,BCL2,CHUK,FOXO1,ACVR1B,MSH2,TP53,CRKL,AKT3,VEGFA,NFKB1,HSP90B1,CCNE1,	2.13E-7
hsa05212	Pancreatic cancer	CCND1,IKBKG,AKT3,CHUK,VEGFA,ACVR1B,NFKB1,TP53,	4.53E-6
hsa05220	Chronic myeloid leukemia	CCND1,IKBKG,CRKL,AKT3,CHUK,ACVR1B,NFKB1,TP53,	5.98E-6
hsa05222	Small cell lung cancer	CCND1,IKBKG,BCL2,AKT3,CHUK,NFKB1,CCNE1,TP53,	1.27E-5

hsa05210	Colorectal cancer	JUN,CCND1,BCL2,AKT3,ACVR1B,MSH2,TP53,	1.34E-4
hsa04010	MAPK signaling pathway	JUN,IKBKG,CRKL,AKT3,CHUK,PLA2G2D,HSPA1A,ATF2,ACVR1B,NFKB1,TP53,	1.78E-4
hsa04210	Apoptosis	IKBKG,BCL2,AKT3,CHUK,NFKB1,TP53,	1.37E-2
hsa05221	Acute myeloid leukemia	CCND1,IKBKG,AKT3,CHUK,NFKB1,	2.20E-2
hsa04621	NOD-like receptor signaling pathway	IKBKG,CHUK,CARD8,NFKB1,HSP90B1,	2.81E-2
hsa04660	T cell receptor signaling pathway	JUN,IFNG,IKBKG,AKT3,CHUK,NFKB1,	3.57E-2
hsa05120	Epithelial cell signaling in Helicobacter pylori infection	JUN,IKBKG,CHUK,ATP6AP1,NFKB1,	3.94E-2
hsa04662	B cell receptor signaling pathway	JUN,IKBKG,AKT3,CHUK,NFKB1,	5.60E-2
hsa04722	Neurotrophin signaling pathway	JUN,CRKL,BCL2,AKT3,NFKB1,TP53,	6.43E-2
hsa04110	Cell cycle	CCND1,CDC14B,CDC25A,CCND2,CCNE1,TP53,	6.65E-2
hsa04510	Focal adhesion	JUN,CCND1,CRKL,BCL2,AKT3,VEGFA,CCND2,	1.19E-1
hsa04310	Wnt signaling pathway	JUN,CCND1,WNT3A,CCND2,BTRC,TP53,	1.43E-1
hsa04620	Toll-like receptor signaling pathway	JUN,IKBKG,AKT3,CHUK,NFKB1,	1.56E-1
hsa04920	Adipocytokine signaling pathway	IKBKG,AKT3,CHUK,NFKB1,	2.61E-1
hsa04115	p53 signaling pathway	CCND1,CCND2,CCNE1,TP53,	2.72E-1
hsa05211	Renal cell carcinoma	JUN,CRKL,AKT3,VEGFA,	2.93E-1
hsa04910	Insulin signaling pathway	CRKL,AKT3,FASN,PHKB,FOXO1,	4.00E-1
hsa05219	Bladder cancer	CCND1,VEGFA,TP53,	6.13E-1
hsa05213	Endometrial cancer	CCND1,AKT3,TP53,	8.89E-1
hsa05223	Non-small cell lung cancer	CCND1,AKT3,TP53,	9.49E-1
hsa04623	Cytosolic DNA-sensing pathway	IKBKG,CHUK,NFKB1,	9.78E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0007049	cell cycle	CCND1,BCL2,BRCA1,ACVR1B,PSMC4,MSH2,CEP63,TSPYL2,BTRC,TP53,APP,PDCD6IP,IFNG,CENPJ,CREBL2,CDC25A,CCND2,MAPK6,DMTF1,CCNE1,RAD51C,	8.80E-6
GO:0051726	regulation of cell cycle	CCND1,JUN,BCL2,BRCA1,MSH2,CEP63,TSPYL2,TP53,PDCD4,APP,GTF2H1,CDC25A,CCND2,	2.65E-5
GO:0042981	regulation of apoptosis	JUN,CADM1,IKBKG,BCL2,FOXO1,BRCA1,GCLM,HSPA1A,ACVR1B,MSH2,TP53,APP,MCL1,IFNG,VEGFA,TIA1,PRDX3,CARD8,NFKB1,HSP90B1,	5.02E-5
GO:0043067	regulation of programmed cell death	JUN,CADM1,IKBKG,BCL2,FOXO1,BRCA1,GCLM,HSPA1A,ACVR1B,MSH2,TP53,APP,MCL1,IFNG,VEGFA,TIA1,PRDX3,CARD8,NFKB1,HSP90B1,	5.74E-5
GO:0010941	regulation of cell death	JUN,CADM1,IKBKG,BCL2,FOXO1,BRCA1,GCLM,HSPA1A,ACVR1B,MSH2,TP53,APP,MCL1,IFNG,VEGFA,TIA1,PRDX3,CARD8,NFKB1,HSP90B1,	6.03E-5

GO:0022402	cell cycle process	CCND1,BCL2,BRCA1,ACVR1B,PSMC4,MSH2,CEP63,BTRC,TP53,APP,IFNG,CENPJ,CDC25A,CCND2,CCNE1,RAD51C,	9.48E-5
GO:0000082	G1/S transition of mitotic cell cycle	CCND1,BCL2,CDC25A,ACVR1B,CCND2,CCNE1,	1.14E-4
GO:0046907	intracellular transport	JUN,RAB9B,BCL2,SEC63,RHOT1,TP53,WIPF1,APP,RGPD5,IFNG,UCP2,VPS45,SNX6,KIF1A,ATP6AP1,PREB,GOLGA5,	1.49E-4
GO:0042325	regulation of phosphorylation	CCND1,JUN,IKBKG,BCL2,ADORA2B,TSPYL2,PDCD4,APP,GTF2H1,IFNG,CDC25A,PRDX3,SNX6,CCND2,	1.76E-4
GO:0008284	positive regulation of cell proliferation	CCND1,JUN,BCL2,CIAO1,BMI1,PURA,IFNG,VEGFA,PRDX3,CCND2,ATP6AP1,NOP2,ODC1,	2.23E-4
GO:0051329	interphase of mitotic cell cycle	CCND1,BCL2,CDC25A,ACVR1B,CCND2,CCNE1,APP,	2.53E-4
GO:0051174	regulation of phosphorus metabolic process	CCND1,JUN,IKBKG,BCL2,ADORA2B,TSPYL2,PDCD4,APP,GTF2H1,IFNG,CDC25A,PRDX3,SNX6,CCND2,	2.60E-4
GO:0019220	regulation of phosphate metabolic process	CCND1,JUN,IKBKG,BCL2,ADORA2B,TSPYL2,PDCD4,APP,GTF2H1,IFNG,CDC25A,PRDX3,SNX6,CCND2,	2.60E-4
GO:0051325	interphase	CCND1,BCL2,CDC25A,ACVR1B,CCND2,CCNE1,APP,	2.96E-4
GO:0008406	gonad development	CCND1,BCL2,VEGFA,MSH2,CCND2,CCNE1,WT1,	3.99E-4
GO:0006915	apoptosis	JUN,CADM1,BCL2,BRCA1,MSH2,RHOT1,TP53,PDCD4,APP,MCL1,PDCD6IP,IFNG,TIA1,CARD8,NFKB1,	6.30E-4
GO:0012501	programmed cell death	JUN,CADM1,BCL2,BRCA1,MSH2,RHOT1,TP53,PDCD4,APP,MCL1,PDCD6IP,IFNG,TIA1,CARD8,NFKB1,	7.28E-4
GO:0048608	reproductive structure development	CCND1,BCL2,VEGFA,MSH2,CCND2,CCNE1,WT1,	7.45E-4
GO:0000077	DNA damage checkpoint	CCND1,BRCA1,CEP63,MSH2,TP53,	7.46E-4
GO:0032268	regulation of cellular protein metabolic process	CCND1,JUN,BCL2,HRSP12,BRCA1,PSMC4,BTRC,PDCD4,APP,IFNG,TIA1,CCND2,NFKB1,	7.53E-4
GO:0045137	development of primary sexual characteristics	CCND1,BCL2,VEGFA,MSH2,CCND2,CCNE1,WT1,	7.77E-4
GO:0043066	negative regulation of apoptosis	BCL2,VEGFA,FOXO1,PRDX3,GCLM,HSPA1A,MSH2,NFKB1,HSP90B1,TP53,MCL1,	9.25E-4
GO:0043549	regulation of kinase activity	CCND1,GTF2H1,IKBKG,CDC25A,PRDX3,ADORA2B,SNX6,CCND2,TSPYL2,PDCD4,APP,	9.86E-4
GO:0031570	DNA integrity checkpoint	CCND1,BRCA1,CEP63,MSH2,TP53,	1.01E-2
GO:0043069	negative regulation of programmed cell death	BCL2,VEGFA,FOXO1,PRDX3,GCLM,HSPA1A,MSH2,NFKB1,HSP90B1,TP53,MCL1,	1.02E-2
GO:0043523	regulation of neuron apoptosis	JUN,BCL2,PRDX3,GCLM,MSH2,TP53,	1.04E-2
GO:0060548	negative regulation of cell death	BCL2,VEGFA,FOXO1,PRDX3,GCLM,HSPA1A,MSH2,NFKB1,HSP90B1,TP53,MCL1,	1.05E-2
GO:0042127	regulation of cell proliferation	CCND1,JUN,BCL2,CIAO1,FOXO1,BMI1,BRCA1,TP53,SKAP2,PURA,IFNG,VEGFA,PRDX3,CCND2,ATP6AP1,NOP2,ODC1,	1.08E-2
GO:0033554	cellular response to stress	CCND1,JUN,BCL2,BRCA1,ADORA2B,MSH2,CEP63,PMS1,TP53,GTF2H1,IFNG,CRKL,PRDX3,RAD51C,	1.11E-2
GO:0008219	cell death	JUN,CADM1,BCL2,BRCA1,MSH2,RHOT1,TP53,PDCD4,APP,MCL1,PDCD6IP,IFNG,TIA1,CARD8,ATP6AP1,NFKB1,	1.21E-2
GO:0016310	phosphorylation	CCND1,BCL2,CHUK,ADORA2B,ACVR1B,MSH2,DSTYK,APP,ND4L,IFNG,AKT3,UGP2,ATP6AP1,MAPK6,TRIM28,RNASEL,GOLGA5,	1.29E-2
GO:0016265	death	JUN,CADM1,BCL2,BRCA1,MSH2,RHOT1,TP53,PDCD4,APP,MCL1,PDCD6IP,IFNG,TIA1,CARD8,ATP6AP1,NFKB1,	1.30E-2
GO:0051338	regulation of transferase activity	CCND1,GTF2H1,IKBKG,CDC25A,PRDX3,ADORA2B,SNX6,CCND2,TSPYL2,PDCD4,APP,	1.34E-2
GO:0044093	positive regulation of molecular function	CCND1,IKBKG,BCL2,CALD1,GCLM,ADORA2B,PSMC4,MSH2,BTRC,TP53,IFNG,PRDX3,CARD8,CCND2,	1.52E-2
GO:0006793	phosphorus metabolic process	CDC14B,CCND1,BCL2,CHUK,ADORA2B,ACVR1B,MSH2,DSTYK,APP,ND4L,IFNG,AKT3,UGP2,CDC25A,ATP6AP1,MAPK6,TRIM28,RNASEL,GOLGA5,	1.53E-2
GO:0006796	phosphate metabolic process	CDC14B,CCND1,BCL2,CHUK,ADORA2B,ACVR1B,MSH2,DSTYK,APP,ND4L,IFNG,AKT3,UGP2,CDC25A,ATP6AP1,MAPK6,TRIM28,RNASEL,GOLGA5,	1.53E-2
GO:0010212	response to ionizing radiation	CCND1,BCL2,BRCA1,MSH2,TP53,	1.72E-2
GO:0048534	hemopoietic or lymphoid organ development	WNT3A,CRKL,BCL2,CHUK,VEGFA,PRDX3,BMI1,MSH2,TP53,	1.77E-2
GO:0007548	sex differentiation	CCND1,BCL2,VEGFA,MSH2,CCND2,CCNE1,WT1,	1.89E-2
GO:0007568	aging	JUN,BCL2,MSH2,ATP6AP1,PDCD4,TP53,	2.54E-2
GO:0002520	immune system development	WNT3A,CRKL,BCL2,CHUK,VEGFA,PRDX3,BMI1,MSH2,TP53,	2.57E-2
GO:0010604	positive regulation of macromolecule metabolic process	JUN,CCND1,BCL2,FOXO1,BRCA1,PSMC4,BTRC,WT1,TP53,APP,GTF2H1,IFNG,VEGFA,CCND2,NFKB1,TRIM28,CCNE1,	2.60E-2
GO:0045893	positive regulation of transcription, DNA-dependent	JUN,GTF2H1,IFNG,VEGFA,FOXO1,BRCA1,NFKB1,TRIM28,CCNE1,WT1,TP53,APP,	2.61E-2
GO:0051254	positive regulation of RNA metabolic process	JUN,GTF2H1,IFNG,VEGFA,FOXO1,BRCA1,NFKB1,TRIM28,CCNE1,WT1,TP53,APP,	2.79E-2
GO:0045859	regulation of protein kinase activity	CCND1,GTF2H1,IKBKG,CDC25A,ADORA2B,SNX6,CCND2,TSPYL2,PDCD4,APP,	2.86E-2
GO:0051052	regulation of DNA metabolic process	JUN,IFNG,BRCA1,MSH2,TSPYL2,TP53,	2.97E-2
GO:0045449	regulation of transcription	JUN,IKBKG,CHD4,BMI1,WT1,PDCD4,ASXL2,IFNG,VEGFA,CREBL2,ATF2,SNX6,TFAM,ATP6AP1,TRIM28,PREB,CNOT6,CIAO1,FOXO1,PNN,BRCA1,ACVR1B,TSPYL2,TP53,APP,MYBL1,PURA,MYB,GTF2H1,BRWD1,PRDX3,NAB1,DMTF1,NFKB1,ZNF559,CCNE1,	2.99E-2
GO:0000060	protein import into nucleus, translocation	JUN,IFNG,ATP6AP1,TP53,	3.02E-2
GO:0014070	response to organic cyclic substance	JUN,CCND1,BCL2,MSH2,CCND2,CCNE1,	3.83E-2
GO:0051301	cell division	CCND1,CDC14B,PDCD6IP,CENPJ,WNT3A,CDC25A,CEP63,CCND2,CCNE1,	3.86E-2
GO:0031399	regulation of protein modification process	JUN,CCND1,IFNG,BCL2,BRCA1,PSMC4,CCND2,BTRC,PDCD4,	3.86E-2
GO:0030097	hemopoiesis	WNT3A,BCL2,CHUK,VEGFA,PRDX3,BMI1,MSH2,TP53,	4.19E-2
GO:0000278	mitotic cell cycle	CCND1,BCL2,CDC25A,ACVR1B,CEP63,PSMC4,CCND2,BTRC,CCNE1,APP,	4.53E-2
GO:0042770	DNA damage response, signal transduction	CCND1,BRCA1,CEP63,MSH2,TP53,	4.92E-2
GO:0043085	positive regulation of catalytic activity	CCND1,IFNG,IKBKG,BCL2,ADORA2B,GCLM,CARD8,MSH2,PSMC4,CCND2,BTRC,TP53,	5.02E-2
GO:0001541	ovarian follicle development	BCL2,VEGFA,CCND2,CCNE1,	5.16E-2
GO:0031401	positive regulation of protein modification process	CCND1,IFNG,BCL2,BRCA1,PSMC4,CCND2,BTRC,	5.44E-2
GO:0019725	cellular homeostasis	JUN,BCL2,CLCN3,PRDX3,GCLM,RHOT1,NAB1,HSP90B1,TP53,APP,MCL1,	6.71E-2
GO:0010165	response to X-ray	CCND1,MSH2,TP53,	7.11E-2
GO:0045935	positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	JUN,FOXO1,BRCA1,ADORA2B,WT1,TP53,APP,GTF2H1,IFNG,VEGFA,NFKB1,TRIM28,CCNE1,	7.20E-2
GO:0000075	cell cycle checkpoint	CCND1,BRCA1,CEP63,MSH2,TP53,	7.73E-2
GO:0051412	response to corticosterone stimulus	CCND1,BCL2,CCNE1,	8.08E-2
GO:0006916	anti-apoptosis	BCL2,VEGFA,FOXO1,HSPA1A,NFKB1,HSP90B1,MCL1,	8.60E-2
GO:0045941	positive regulation of transcription	JUN,GTF2H1,IFNG,VEGFA,FOXO1,BRCA1,NFKB1,TRIM28,CCNE1,WT1,TP53,APP,	9.04E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	JUN,FOXO1,BRCA1,ADORA2B,WT1,TP53,APP,GTF2H1,IFNG,VEGFA,NFKB1,TRIM28,CCNE1,	9.15E-2
GO:0043524	negative regulation of neuron apoptosis	BCL2,PRDX3,GCLM,MSH2,	9.48E-2
GO:0008584	male gonad development	CCND1,BCL2,MSH2,WT1,	1.00E-1
GO:0030705	cytoskeleton-dependent intracellular transport	RHOT1,KIF1A,WIPF1,APP,	1.00E-1
GO:0010605	negative regulation of macromolecule metabolic process	JUN,BRCA1,PSMC4,MSH2,TSPYL2,WT1,TP53,PDCD4,PURA,TIA1,SNX6,NAB1,NFKB1,TRIM28,	1.00E-1

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value