ncRNADetailInformation

Detail Information

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-153

MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0000439 hsa-miR-153-3p	UUGCAUAGUCACAAAAGUGAUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0026480 hsa-miR-153-5p	UCAUUUUUGUGAUGUUGCAGCU	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0000439 hsa-miR-153-3p	UUGCAUAGUCACAAAAGUGAUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0026480 hsa-miR-153-5p	UCAUUUUUGUGAUGUUGCAGCU	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0000439 hsa-miR-153-3p	UUGCAUAGUCACAAAAGUGAUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0026480 hsa-miR-153-5p	UCAUUUUUGUGAUGUUGCAGCU	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0000439 hsa-miR-153-3p	UUGCAUAGUCACAAAAGUGAUC	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000464	MIPF0000050	AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG	MIMAT0026480 hsa-miR-153-5p	UCAUUUUUGUGAUGUUGCAGCU	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000462	MIPF0000056	UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGAAGGACC	MIMAT0000438 hsa-miR-152-3p	UCAGUGCAUGACAGAACUUGG	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .
MI0000462	MIPF0000056	UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGAAGGACC	MIMAT0026479 hsa-miR-152-5p	AGGUUCUGUGAUACACUCCGACU	This miRNA sequence is predicted based on homology to a verified miRNAfrom mouse , later verified in human .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

MCL1,PPM1D,APP,IRS2,SNAI1,FOXO1,SNCA,ZEB2,NFE2L2
more » MCL1,PPM1D,APP,IRS2,SNAI1,FOXO1,SNCA,ZEB2,NFE2L2

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0010033	response to organic substance	BCL2,SNCA,FOXO1,IRS2,NFE2L2,MCL1,	4.46E-5
GO:0010604	positive regulation of macromolecule metabolic process	BCL2,SNCA,FOXO1,IRS2,NFE2L2,APP,	1.02E-4
GO:0006916	anti-apoptosis	BCL2,SNCA,FOXO1,MCL1,	2.73E-4
GO:0042592	homeostatic process	BCL2,SNCA,IRS2,APP,MCL1,	9.48E-4
GO:0034097	response to cytokine stimulus	BCL2,SNCA,MCL1,	1.18E-2

GO:0042981	regulation of apoptosis	BCL2,SNCA,FOXO1,APP,MCL1,	1.22E-2
GO:0043067	regulation of programmed cell death	BCL2,SNCA,FOXO1,APP,MCL1,	1.27E-2
GO:0010941	regulation of cell death	BCL2,SNCA,FOXO1,APP,MCL1,	1.29E-2
GO:0043066	negative regulation of apoptosis	BCL2,SNCA,FOXO1,MCL1,	1.32E-2
GO:0043069	negative regulation of programmed cell death	BCL2,SNCA,FOXO1,MCL1,	1.38E-2
GO:0060548	negative regulation of cell death	BCL2,SNCA,FOXO1,MCL1,	1.39E-2
GO:0051329	interphase of mitotic cell cycle	PPM1D,BCL2,APP,	1.99E-2
GO:0051325	interphase	PPM1D,BCL2,APP,	2.11E-2
GO:0019725	cellular homeostasis	BCL2,SNCA,APP,MCL1,	2.92E-2
GO:0032268	regulation of cellular protein metabolic process	BCL2,SNCA,ZEB2,APP,	3.06E-2
GO:0051051	negative regulation of transport	BCL2,SNCA,IRS2,	3.39E-2
GO:0048878	chemical homeostasis	BCL2,SNCA,IRS2,APP,	3.81E-2
GO:0043434	response to peptide hormone stimulus	BCL2,FOXO1,IRS2,	4.39E-2
GO:0032469	endoplasmic reticulum calcium ion homeostasis	BCL2,APP,	5.31E-2
GO:0048729	tissue morphogenesis	BCL2,SNAI1,ZEB2,	5.96E-2
GO:0040012	regulation of locomotion	BCL2,SNCA,IRS2,	6.75E-2
GO:0009314	response to radiation	PPM1D,BCL2,APP,	7.31E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	FOXO1,IRS2,NFE2L2,APP,	7.58E-2
GO:0010039	response to iron ion	BCL2,SNCA,	7.95E-2
GO:0031328	positive regulation of cellular biosynthetic process	FOXO1,IRS2,NFE2L2,APP,	8.63E-2
GO:0009891	positive regulation of biosynthetic process	FOXO1,IRS2,NFE2L2,APP,	8.98E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value