ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-143

MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0006871	MIPF0000094	GAUGUCUCCCAGCCCAAGGUGCAGUGCUGCAUCUCUGGUCAGUUGUGAGUCUGAGAUGAAGCACUGUAGCUCGGGAAGGGAGGAGCUGUC	MIMAT0007144 oan-miR-143-3p	UGAGAUGAAGCACUGUAGCUC
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0004599 hsa-miR-143-5p	GGUGCAGUGCUGCAUCUCUGGU	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.
MI0000459	MIPF0000094	GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC	MIMAT0000435 hsa-miR-143-3p	UGAGAUGAAGCACUGUAGCUC	This miRNA sequence was predicted based on homology to a verified miRNAfrom mouse . Michael et al. subsequently verified expression ofmiR-143 in human, and demonstrated significantly reduced levels of themiRNA in precancerous and neoplastic colorectal tissue . miR-143cloned in has a 1 nt 3' extension (A), which is incompatible with thegenome sequence.

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

MAPK7,BMP4,PLK1,TP53,AKT1,PRODH,COL1A1,MMP13,FSCN1,FHIT,HRAS,COX2,MYO6,FNDC3B,IGF1R
more » MAPK7,BMP4,PLK1,TP53,AKT1,PRODH,COL1A1,MMP13,FSCN1,FHIT,HRAS,COX2,MYO6,FNDC3B,IGF1R,KRAS,MDM2,MACC1,SERPINE1,TP53INP1,DNMT3A,BCL2,HK2

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05215	Prostate cancer	IGF1R,HRAS,BCL2,KRAS,MDM2,AKT1,TP53,	1.68E-7
hsa05214	Glioma	IGF1R,HRAS,KRAS,MDM2,AKT1,TP53,	9.77E-7
hsa05218	Melanoma	IGF1R,HRAS,KRAS,MDM2,AKT1,TP53,	1.78E-6
hsa05223	Non-small cell lung cancer	HRAS,FHIT,KRAS,AKT1,TP53,	1.88E-5
hsa04722	Neurotrophin signaling pathway	HRAS,BCL2,KRAS,MAPK7,AKT1,TP53,	2.80E-5

hsa05200	Pathways in cancer	IGF1R,HRAS,BCL2,BMP4,KRAS,MDM2,AKT1,TP53,	3.00E-5
hsa05220	Chronic myeloid leukemia	HRAS,KRAS,MDM2,AKT1,TP53,	6.94E-5
hsa05210	Colorectal cancer	IGF1R,BCL2,KRAS,AKT1,TP53,	1.08E-4
hsa05219	Bladder cancer	HRAS,KRAS,MDM2,TP53,	2.72E-4
hsa05213	Endometrial cancer	HRAS,KRAS,AKT1,TP53,	5.14E-4
hsa05222	Small cell lung cancer	FHIT,BCL2,AKT1,TP53,	2.08E-2
hsa04914	Progesterone-mediated oocyte maturation	IGF1R,PLK1,KRAS,AKT1,	2.23E-2
hsa04510	Focal adhesion	IGF1R,HRAS,BCL2,COL1A1,AKT1,	2.96E-2
hsa05216	Thyroid cancer	HRAS,KRAS,TP53,	3.58E-2
hsa04910	Insulin signaling pathway	HK2,HRAS,KRAS,AKT1,	7.95E-2
hsa04010	MAPK signaling pathway	HRAS,KRAS,MAPK7,AKT1,TP53,	8.19E-2
hsa05221	Acute myeloid leukemia	HRAS,KRAS,AKT1,	1.38E-1
hsa04115	p53 signaling pathway	MDM2,SERPINE1,TP53,	1.87E-1
hsa04730	Long-term depression	IGF1R,HRAS,KRAS,	1.92E-1
hsa05211	Renal cell carcinoma	HRAS,KRAS,AKT1,	1.97E-1
hsa05212	Pancreatic cancer	KRAS,AKT1,TP53,	2.08E-1
hsa04370	VEGF signaling pathway	HRAS,KRAS,AKT1,	2.25E-1
hsa04662	B cell receptor signaling pathway	HRAS,KRAS,AKT1,	2.25E-1
hsa04664	Fc epsilon RI signaling pathway	HRAS,KRAS,AKT1,	2.42E-1
hsa04210	Apoptosis	BCL2,AKT1,TP53,	2.97E-1
hsa04012	ErbB signaling pathway	HRAS,KRAS,AKT1,	2.97E-1
hsa04540	Gap junction	HRAS,KRAS,MAPK7,	3.10E-1
hsa04912	GnRH signaling pathway	HRAS,KRAS,MAPK7,	3.70E-1
hsa04660	T cell receptor signaling pathway	HRAS,KRAS,AKT1,	4.41E-1
hsa04110	Cell cycle	PLK1,MDM2,TP53,	5.74E-1
hsa04530	Tight junction	HRAS,KRAS,AKT1,	6.49E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0007569	cell aging	HRAS,BCL2,KRAS,SERPINE1,TP53,	2.51E-7
GO:0009628	response to abiotic stimulus	HRAS,BCL2,COL1A1,BMP4,KRAS,MMP13,AKT1,TP53,	1.75E-6
GO:0009725	response to hormone stimulus	IGF1R,BCL2,COL1A1,BMP4,KRAS,MMP13,AKT1,	2.61E-5
GO:0007568	aging	HRAS,BCL2,KRAS,SERPINE1,TP53,	3.25E-5
GO:0010941	regulation of cell death	IGF1R,HRAS,TP53INP1,BCL2,BMP4,KRAS,PRODH,AKT1,TP53,	3.65E-5

GO:0006915	apoptosis	HRAS,TP53INP1,BCL2,KRAS,MAPK7,AKT1,TP53,KRT8,	4.38E-5
GO:0009719	response to endogenous stimulus	IGF1R,BCL2,COL1A1,BMP4,KRAS,MMP13,AKT1,	4.54E-5
GO:0012501	programmed cell death	HRAS,TP53INP1,BCL2,KRAS,MAPK7,AKT1,TP53,KRT8,	4.81E-5
GO:0010604	positive regulation of macromolecule metabolic process	IGF1R,HRAS,BCL2,PLK1,MYO6,BMP4,MDM2,AKT1,TP53,	5.23E-5
GO:0009416	response to light stimulus	HRAS,BCL2,KRAS,AKT1,TP53,	7.89E-5
GO:0008219	cell death	HRAS,TP53INP1,BCL2,KRAS,MAPK7,AKT1,TP53,KRT8,	1.34E-4
GO:0016265	death	HRAS,TP53INP1,BCL2,KRAS,MAPK7,AKT1,TP53,KRT8,	1.40E-4
GO:0042127	regulation of cell proliferation	IGF1R,HRAS,BCL2,BMP4,KRAS,MDM2,SERPINE1,TP53,	2.36E-4
GO:0042981	regulation of apoptosis	IGF1R,HRAS,TP53INP1,BCL2,KRAS,PRODH,AKT1,TP53,	2.69E-4
GO:0043066	negative regulation of apoptosis	IGF1R,HRAS,BCL2,KRAS,AKT1,TP53,	2.72E-4
GO:0048545	response to steroid hormone stimulus	BCL2,COL1A1,BMP4,KRAS,MMP13,	2.81E-4
GO:0043067	regulation of programmed cell death	IGF1R,HRAS,TP53INP1,BCL2,KRAS,PRODH,AKT1,TP53,	2.86E-4
GO:0043069	negative regulation of programmed cell death	IGF1R,HRAS,BCL2,KRAS,AKT1,TP53,	2.90E-4
GO:0060548	negative regulation of cell death	IGF1R,HRAS,BCL2,KRAS,AKT1,TP53,	2.94E-4
GO:0031667	response to nutrient levels	BCL2,COL1A1,BMP4,AKT1,TP53,	3.10E-4
GO:0009314	response to radiation	HRAS,BCL2,KRAS,AKT1,TP53,	3.29E-4
GO:0031960	response to corticosteroid stimulus	BCL2,COL1A1,BMP4,KRAS,	3.87E-4
GO:0048589	developmental growth	BCL2,BMP4,AKT1,SERPINE1,	4.14E-4
GO:0043523	regulation of neuron apoptosis	HRAS,BCL2,KRAS,TP53,	4.57E-4
GO:0009991	response to extracellular stimulus	BCL2,COL1A1,BMP4,AKT1,TP53,	4.72E-4
GO:0008284	positive regulation of cell proliferation	IGF1R,HRAS,BCL2,BMP4,KRAS,MDM2,	5.58E-4
GO:0032270	positive regulation of cellular protein metabolic process	BCL2,PLK1,BMP4,MDM2,AKT1,	5.86E-4
GO:0030029	actin filament-based process	HRAS,BCL2,FSCN1,MYO6,KRAS,	6.66E-4
GO:0051247	positive regulation of protein metabolic process	BCL2,PLK1,BMP4,MDM2,AKT1,	6.87E-4
GO:0010942	positive regulation of cell death	TP53INP1,BCL2,BMP4,PRODH,AKT1,TP53,	6.99E-4
GO:0001503	ossification	BCL2,COL1A1,BMP4,MMP13,	9.36E-4
GO:0010033	response to organic substance	IGF1R,BCL2,COL1A1,BMP4,KRAS,MMP13,AKT1,	1.03E-2
GO:0060348	bone development	BCL2,COL1A1,BMP4,MMP13,	1.13E-2
GO:0008637	apoptotic mitochondrial changes	BCL2,AKT1,TP53,	1.24E-2
GO:0048732	gland development	HK2,IGF1R,BCL2,BMP4,	1.48E-2
GO:0007049	cell cycle	TP53INP1,BCL2,PLK1,MDM2,MAPK7,AKT1,TP53,	1.51E-2
GO:0016310	phosphorylation	HK2,IGF1R,BCL2,PLK1,COX2,MAPK7,AKT1,	1.77E-2
GO:0051726	regulation of cell cycle	BCL2,BMP4,MDM2,AKT1,TP53,	2.15E-2
GO:0043434	response to peptide hormone stimulus	IGF1R,BCL2,COL1A1,AKT1,	2.16E-2
GO:0022402	cell cycle process	TP53INP1,BCL2,PLK1,MDM2,AKT1,TP53,	2.24E-2
GO:0043524	negative regulation of neuron apoptosis	HRAS,BCL2,KRAS,	3.35E-2
GO:0040007	growth	BCL2,BMP4,AKT1,SERPINE1,	3.53E-2
GO:0016044	membrane organization	HRAS,BCL2,MYO6,KRAS,TP53,	3.58E-2
GO:0051173	positive regulation of nitrogen compound metabolic process	IGF1R,HRAS,MYO6,BMP4,AKT1,TP53,	3.96E-2
GO:0009612	response to mechanical stimulus	COL1A1,BMP4,MMP13,	4.02E-2
GO:0010557	positive regulation of macromolecule biosynthetic process	IGF1R,HRAS,MYO6,BMP4,AKT1,TP53,	4.23E-2
GO:0009411	response to UV	BCL2,AKT1,TP53,	4.46E-2
GO:0006793	phosphorus metabolic process	HK2,IGF1R,BCL2,PLK1,COX2,MAPK7,AKT1,	4.75E-2
GO:0006796	phosphate metabolic process	HK2,IGF1R,BCL2,PLK1,COX2,MAPK7,AKT1,	4.75E-2
GO:0006275	regulation of DNA replication	IGF1R,HRAS,TP53,	4.91E-2
GO:0031328	positive regulation of cellular biosynthetic process	IGF1R,HRAS,MYO6,BMP4,AKT1,TP53,	5.15E-2
GO:0048167	regulation of synaptic plasticity	HRAS,MYO6,KRAS,	5.22E-2
GO:0009891	positive regulation of biosynthetic process	IGF1R,HRAS,MYO6,BMP4,AKT1,TP53,	5.48E-2
GO:0043065	positive regulation of apoptosis	TP53INP1,BCL2,PRODH,AKT1,TP53,	5.51E-2
GO:0043068	positive regulation of programmed cell death	TP53INP1,BCL2,PRODH,AKT1,TP53,	5.65E-2
GO:0007010	cytoskeleton organization	HRAS,BCL2,FSCN1,KRAS,KRT8,	5.79E-2
GO:0008283	cell proliferation	BCL2,FSCN1,PLK1,BMP4,TP53,	5.79E-2
GO:0030036	actin cytoskeleton organization	HRAS,BCL2,FSCN1,KRAS,	6.36E-2
GO:0045597	positive regulation of cell differentiation	BCL2,BMP4,FNDC3B,AKT1,	6.60E-2
GO:0035022	positive regulation of Rac protein signal transduction	HRAS,KRAS,	6.78E-2
GO:0051216	cartilage development	COL1A1,BMP4,MMP13,	6.93E-2
GO:0000302	response to reactive oxygen species	BCL2,COL1A1,SERPINE1,	7.11E-2
GO:0051384	response to glucocorticoid stimulus	BCL2,BMP4,KRAS,	7.67E-2
GO:0032268	regulation of cellular protein metabolic process	BCL2,PLK1,BMP4,MDM2,AKT1,	7.76E-2
GO:0045786	negative regulation of cell cycle	BCL2,BMP4,TP53,	8.25E-2
GO:0002326	B cell lineage commitment	BCL2,TP53,	8.47E-2
GO:0002360	T cell lineage commitment	BCL2,TP53,	8.47E-2
GO:0032504	multicellular organism reproduction	HK2,BCL2,BMP4,AKT1,DNMT3A,	8.52E-2
GO:0048609	reproductive process in a multicellular organism	HK2,BCL2,BMP4,AKT1,DNMT3A,	8.52E-2
GO:0046777	protein amino acid autophosphorylation	IGF1R,MAPK7,AKT1,	9.06E-2
GO:0003006	reproductive developmental process	IGF1R,BCL2,BMP4,AKT1,	9.54E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value