ncRNADetailInformation

Detail Information
Functional analysis

miRNA name

pre-miRNA

family

pre-miRNA Sequence

mature-miRNA

mature sequence

pre-miRNA description

miR-10b

MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0004556 hsa-miR-10b-3p	ACAGAUUCGAUUCUAGGGGAAU	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .
MI0000267	MIPF0000033	CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA	MIMAT0000254 hsa-miR-10b-5p	UACCCUGUAGAACCGAAUUUGUG	This human miRNA was predicted by computational methods using conservationwith mouse and Fugu rubripes sequences . Expression of the excised miRhas been validated in zebrafish, and the ends mapped by cloning. Michaelet al. subsequently verified expression of miR-10b in human . Themature sequence shown here represents the most commonly cloned form fromlarge-scale cloning studies .

link to database

TargetScanS 6.2 | MicroCosm | microRNA.org | miRNAMap 2.0

Interacted genes from RAID,miRTarBase

ACTG1,HNRNPF,TFAP2C,TUBA1B,PABPC1,FASN,GRINA,SLC25A30,THUMPD1,GK,ZC3H18,ARFGEF1,FAM13A,APLNR,GLOD4
more » ACTG1,HNRNPF,TFAP2C,TUBA1B,PABPC1,FASN,GRINA,SLC25A30,THUMPD1,GK,ZC3H18,ARFGEF1,FAM13A,APLNR,GLOD4,TRA2B,CDKN2A,CDK12,EXTL3,DIAPH2,ADRA1B,PAX6,PTPRT,RPS9,PSMD11,IPCEF1,SCMH1,ND6,PSMD13,INHBA,LMF2,LEMD3,RTKN2,CAMSAP3,HK1,EPHA4,CSNK2A1,ESYT1,PRMT7,CTBP1,CYLD,CLPTM1,PTCH1,RPS8,USP3,EIF1,DLAT,MAPRE1,C6orf106,UHRF1,PPP1R13B,PRRC2C,PRPF8,NCOR2,SYT11,POLR2A,NF1,UBE2Z,STK33,XPO7,SLC2A3,GBAS,WHSC1L1,PARL,COPS5,LRRC59,PFAS,CHPF2,KIAA0100,TXNDC16,GLB1L3,COL6A2,DMWD,NR4A3,MSL3,FUT6,CDKN1A,LSS,TP53,KLF4,NRP2,BCL2L11,RALBP1,UROD,IGSF1,SETD7,AASDH,FEM1B,SMCHD1,TIMP3,ODZ3,LRP3,ERLIN1,HOXD10,ATG13,PIK3CD,MSTO1,PLA2G4F,AP3M1,SURF6,NUFIP2,SDC1,DDHD2,PIEZO1,PPP3CB,LAMC1,SRSF1,C9orf114,ZNF318,HIST1H2AL,PPARA,ORAI2,SLC25A5,STT3A,RUNDC3B,TSPAN33,ACLY,CDK2,FOXO3,RBM17,NOTCH1,NEK7,AMMECR1,NPTX1,KBTBD6,RGP1,NAP1L1,TWIST1,HSPA1B

KEGG pathways enriched for interacted genes

pathway name

pathway description

target genes enrich in pathway

p-value

hsa05220	Chronic myeloid leukemia	CTBP1,PIK3CD,CDKN2A,CDKN1A,TP53,	9.55E-2
hsa05223	Non-small cell lung cancer	PIK3CD,FOXO3,CDKN2A,TP53,	2.21E-1
hsa05200	Pathways in cancer	CTBP1,PIK3CD,LAMC1,CDK2,CDKN2A,RALBP1,CDKN1A,PTCH1,TP53,	2.84E-1
hsa05214	Glioma	PIK3CD,CDKN2A,CDKN1A,TP53,	3.30E-1
hsa04115	p53 signaling pathway	CDK2,CDKN2A,CDKN1A,TP53,	4.00E-1

Gene ontology terms enriched for interacted genes

GO terms

GO terms description

target genes enrich in GO term

p-value

GO:0035137	hindlimb morphogenesis	TWIST1,NOTCH1,HOXD10,PTCH1,	9.81E-4
GO:0045596	negative regulation of cell differentiation	PPARA,TWIST1,NF1,NOTCH1,KLF4,PAX6,TP53,INHBA,	1.30E-2
GO:0043065	positive regulation of apoptosis	NF1,FOXO3,NOTCH1,CDKN2A,TIMP3,CDKN1A,BCL2L11,PPP1R13B,TP53,FEM1B,INHBA,	1.60E-2
GO:0043068	positive regulation of programmed cell death	NF1,FOXO3,NOTCH1,CDKN2A,TIMP3,CDKN1A,BCL2L11,PPP1R13B,TP53,FEM1B,INHBA,	1.68E-2
GO:0010942	positive regulation of cell death	NF1,FOXO3,NOTCH1,CDKN2A,TIMP3,CDKN1A,BCL2L11,PPP1R13B,TP53,FEM1B,INHBA,	1.74E-2

GO:0006917	induction of apoptosis	FOXO3,CDKN2A,TIMP3,CDKN1A,BCL2L11,PPP1R13B,TP53,FEM1B,INHBA,	3.04E-2
GO:0012502	induction of programmed cell death	FOXO3,CDKN2A,TIMP3,CDKN1A,BCL2L11,PPP1R13B,TP53,FEM1B,INHBA,	3.10E-2
GO:0045786	negative regulation of cell cycle	CDKN2A,CDKN1A,PPP1R13B,TP53,INHBA,	3.36E-2
GO:0006357	regulation of transcription from RNA polymerase II promoter	NCOR2,TWIST1,CTBP1,TFAP2C,FOXO3,NOTCH1,PAX6,TP53,NR4A3,INHBA,PPARA,UHRF1,KLF4,HOXD10,	3.43E-2
GO:0008361	regulation of cell size	ADRA1B,CDKN2A,CDKN1A,WHSC1L1,TP53,INHBA,EXTL3,	4.87E-2
GO:0008380	RNA splicing	TRA2B,PRMT7,RBM17,HNRNPF,PRPF8,POLR2A,PABPC1,SRSF1,	5.95E-2
GO:0000375	RNA splicing, via transesterification reactions	TRA2B,PRMT7,HNRNPF,PRPF8,POLR2A,SRSF1,	6.24E-2
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	TRA2B,PRMT7,HNRNPF,PRPF8,POLR2A,SRSF1,	6.24E-2
GO:0000398	nuclear mRNA splicing, via spliceosome	TRA2B,PRMT7,HNRNPF,PRPF8,POLR2A,SRSF1,	6.24E-2
GO:0042127	regulation of cell proliferation	CTBP1,NF1,NOTCH1,NAP1L1,CDK2,CDKN2A,PAX6,CDKN1A,PTCH1,TP53,RTKN2,RPS9,LAMC1,KLF4,	6.64E-2
GO:0009991	response to extracellular stimulus	PPARA,ATG13,KLF4,TIMP3,CDKN1A,PTCH1,TP53,	6.67E-2
GO:0016071	mRNA metabolic process	HSPA1B,TRA2B,PRMT7,RBM17,HNRNPF,PRPF8,POLR2A,PABPC1,SRSF1,	7.23E-2
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	PPARA,FOXO3,NOTCH1,KLF4,HOXD10,PAX6,TP53,NR4A3,INHBA,	7.34E-2
GO:0051329	interphase of mitotic cell cycle	CDK2,CDKN2A,CDKN1A,PPP3CB,INHBA,	7.87E-2
GO:0051325	interphase	CDK2,CDKN2A,CDKN1A,PPP3CB,INHBA,	8.70E-2
GO:0000082	G1/S transition of mitotic cell cycle	CDKN2A,CDKN1A,PPP3CB,INHBA,	8.87E-2
GO:0010605	negative regulation of macromolecule metabolic process	PSMD11,NCOR2,TWIST1,CTBP1,PSMD13,ADRA1B,CDKN2A,TP53,SCMH1,INHBA,PPARA,KLF4,TIMP3,	9.80E-2
GO:0045926	negative regulation of growth	CDKN2A,CDKN1A,PTCH1,TP53,INHBA,	9.88E-2

KEGG pathways and Gene Ontology terms enriched for the interacted genes of ncRNA from RAID and miRTarBase.

disease name	related genes	p-value